Home > Mutants (Isolated) > tm11357

Mutants (Isolated)

tm11357

Allele Nametm11357
BalanceNot Required
OutCrossRequest Available
Sequence NameC34C12.7 M01F1.1 M01F1.9 M01F1.8 M01F1.2 M01F1.3
Gene NameC34C12.7 M01F1.1 M01F1.9 M01F1.8 M01F1.2 M01F1.3
Worm BaseAllele Name tm11357
Gene Name C34C12.7 M01F1.1 M01F1.9 M01F1.8 M01F1.2 M01F1.3
Sequence C34C12.7 M01F1.1 M01F1.9 M01F1.8 M01F1.2 M01F1.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C34C12]33138/33139-[M01F1]17050/17051 (18569 bp deletion)
ChromosomeIII
Putative gene structureC34C12.7 = complement(join(32674..32838, 32915..33094, 33460..33584, 33663..33759, 33808..33855)); M01F1.1 = complement(join(3577..3690, 3776..3845, 3899..4008, 4240..4330, 4518..4667, 4911..4990, 5046..5155, 5277..5533, 5651..5706, 5757..5807, 6111..6251, 6299..6382)); M01F1.9 M01F1.8 = complement(join(12635..12768, 13939..14239, 15031..15225, 15293..15487, 15533..15694)); M01F1.2 = complement(join(16047..16243, 16291..16443, 16496..16754)); M01F1.3 = complement(join(16937..17265, 17322..17557, 17602..17903, 17948..18045, 18095..18194))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:GATTATGCTAGGACTGGGCG,ExtFwd:CGAGAATGATGAGAAGACCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication