分離済み変異体

tm11343

Allele Nametm11343
BalanceNot Required
OutCrossRequest Available
Sequence NameY59C2A.2 Y59C2A.4 Y59C2A.1 Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8
Gene NameY59C2A.2 Y59C2A.4 Y59C2A.1 Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8
Worm BaseAllele Name tm11343
Gene Name Y59C2A.2 Y59C2A.4 Y59C2A.1 Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8
Sequence Y59C2A.2 Y59C2A.4 Y59C2A.1 Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y59C2A]56/57-[F54A3]12172/12173 (30929 bp deletion)
ChromosomeII
Putative gene structureY59C2A.2 = complement(join(377..535, 614..859, 1323..1444, 1521..1611, 1738..1827, 2488..2615, 2701..2772, 3053..3152, 3216..3318, 3434..3543, 3630..3731)); Y59C2A.4 Y59C2A.1 = join(7737..7834, 7891..7972, 8338..8501, 9053..9164, 9225..9326, 9809..10030, 10821..10914, 10967..11044, 11242..11369, 11427..11511, 12088..12222, 12280..12344); Y59C2A.3 = complement(join(15142..15753, 16110..16553, 16883..17251, 17414..17809, 18453..18779)); F54A3.4 = complement(join(806..1088, 1274..1318, 1485..1876, 1921..2372, 2566..2672, 2717..3519, 4115..4182, 4229..4346)); F54A3.10 F54A3.5 = complement(join(5291..5464, 6369..6512)); F54A3.6 = complement(join(6711..6830, 7744..8077, 9999..10246, 11217..11348, 11481..11570, 11635..11673, 12275..12343, 12499..12567, 12615..12684, 12728..12782, 12850..12985, 13035..13063, 13116..13137)); F54A3.9 F54A3.8
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:ACCACGATATCACTCAGGAC,ExtFwd:TAGATGTAGAAGAACCGCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication