Mutants (Isolated)

tm1133

Allele Nametm1133
Sequence NameZK1248.14
CGC Namefzo-1
Worm BaseAllele Name tm1133
CGC Name fzo-1
Sequence ZK1248.14
Phenotypehomozygous viable. Dr. J-C. Martinou: not hypersensitive to anoxia, a bit slow growth at 20 degree. Dr. Xue: Mol Cell 31, 586 (2008). Dr. T. Oka: J. Biochem. 143, 449 (2008). Dr. H. Sawa: normal embryonic cell division.
Mutation site26031/26032-GTTCAGCCACATTG-26450/26451 (419 bp deletion + 14 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(24019..24100, 24149..24283, 24330..24800, 24846..24957, 25007..26114, 26166..26383, 26435..26560, 26607..26679))
Map position-0.87
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCTGTCTGCTCACGGTAA,IntFwd:GTCCTGGTGGATTCGTTTAG,ExtRev:CTCATTGCATGTACGGTGTA,IntRev:GAACGGGGGCTTGCTGATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang Y, Lanjuin A, Chowdhury SR, Mistry M, Silva-García CG, Weir HJ, Lee CL, Escoubas CC, Tabakovic E, Mair WB.
Neuronal TORC1 modulates longevity via AMPK and cell nonautonomous regulation of mitochondrial dynamics in C. elegans.
Elife 2019 8  
[ PubMed ID = 31411562 ] [ RRC reference ]

Pryor R, Norvaisas P, Marinos G, Best L, Thingholm LB, Quintaneiro LM, De Haes W, Esser D, Waschina S, Lujan C, Smith RL, Scott TA, Martinez-Martinez D, Woodward O, Bryson K, Laudes M, Lieb W, Houtkooper RH, Franke A, Temmerman L, Bjedov I, Cochemé HM, Kaleta C, Cabreiro F.
Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy.
Cell 2019 178(6) 1299-1312.e29 
[ PubMed ID = 31474368 ] [ RRC reference ]

Charmpilas N, Tavernarakis N.
Mitochondrial maturation drives germline stem cell differentiation in Caenorhabditis elegans.
Cell Death Differ. 2020 27(2) 601-617 
[ PubMed ID = 31217501 ] [ RRC reference ]

Zhou J, Wang X, Wang M, Chang Y, Zhang F, Ban Z, Tang R, Gan Q, Wu S, Guo Y, Zhang Q, Wang F, Zhao L, Jing Y, Qian W, Wang G, Guo W, Yang C.
The lysine catabolite saccharopine impairs development by disrupting mitochondrial homeostasis.
J. Cell Biol. 2019 218(2) 580-597 
[ PubMed ID = 30573525 ] [ RRC reference ]

Yu Y, Mutlu AS, Liu H, Wang MC.
High-throughput screens using photo-highlighting discover BMP signaling in mitochondrial lipid oxidation.
Nat Commun 2017 8(1) 865 
[ PubMed ID = 29021566 ] [ RRC reference ]

Wang Y, Zhang Y, Chen L, Liang Q, Yin XM, Miao L, Kang BH, Xue D.
Kinetics and specificity of paternal mitochondrial elimination in Caenorhabditis elegans.
Nat Commun 2016 7 12569 
[ PubMed ID = 27581092 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet. 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc. Natl. Acad. Sci. U.S.A. 2019 116(43) 21651-21658 
[ PubMed ID = 31591219 ] [ RRC reference ]

Yasuda K, Hartman PS, Ishii T, Suda H, Akatsuka A, Shoyama T, Miyazawa M, Ishii N.
Interrelationships between mitochondrial fusion, energy metabolism and oxidative stress during development in Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2011 404(3) 751-5 
[ PubMed ID = 21144829 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050 
[ PubMed ID = 32103012 ] [ RRC reference ]

Johnson D, Allman E, Nehrke K.
Regulation of acid-base transporters by reactive oxygen species following mitochondrial fragmentation.
Am. J. Physiol., Cell Physiol. 2012 302(7) C1045-54 
[ PubMed ID = 22237403 ] [ RRC reference ]

Ackema KB, Hench J, Böckler S, Wang SC, Sauder U, Mergentaler H, Westermann B, Bard F, Frank S, Spang A.
The small GTPase Arf1 modulates mitochondrial morphology and function.
EMBO J. 2014 33(22) 2659-75 
[ PubMed ID = 25190516 ] [ RRC reference ]

Köhler F, Müller-Rischart AK, Conradt B, Rolland SG.
The loss of LRPPRC function induces the mitochondrial unfolded protein response.
Aging (Albany NY) 2015 7(9) 701-17 
[ PubMed ID = 26412102 ] [ RRC reference ]

Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, Laboy R, Hirschey MD, Mair WB.
Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling.
Cell Metab. 2017 26(6) 884-896.e5 
[ PubMed ID = 29107506 ] [ RRC reference ]

Luz AL, Godebo TR, Smith LL, Leuthner TC, Maurer LL, Meyer JN.
Deficiencies in mitochondrial dynamics sensitize Caenorhabditis elegans to arsenite and other mitochondrial toxicants by reducing mitochondrial adaptability.
Toxicology 2017 387 81-94 
[ PubMed ID = 28602540 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet. 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Bess AS, Crocker TL, Ryde IT, Meyer JN.
Mitochondrial dynamics and autophagy aid in removal of persistent mitochondrial DNA damage in Caenorhabditis elegans.
Nucleic Acids Res. 2012 40(16) 7916-31 
[ PubMed ID = 22718972 ] [ RRC reference ]

Rolland SG, Motori E, Memar N, Hench J, Frank S, Winklhofer KF, Conradt B.
Impaired complex IV activity in response to loss of LRPPRC function can be compensated by mitochondrial hyperfusion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(32) E2967-76 
[ PubMed ID = 23878239 ] [ RRC reference ]

Luz AL, Rooney JP, Kubik LL, Gonzalez CP, Song DH, Meyer JN.
Mitochondrial Morphology and Fundamental Parameters of the Mitochondrial Respiratory Chain Are Altered in Caenorhabditis elegans Strains Deficient in Mitochondrial Dynamics and Homeostasis Processes.
PLoS ONE 2015 10(6) e0130940 
[ PubMed ID = 26106885 ] [ RRC reference ]