Mutants (Isolated)

tm1133

Allele Nametm1133
Sequence NameZK1248.14
CGC Namefzo-1
Worm BaseAllele Name tm1133
CGC Name fzo-1
Sequence ZK1248.14
Phenotypehomozygous viable. Dr. J-C. Martinou: not hypersensitive to anoxia, a bit slow growth at 20 degree. Dr. Xue: Mol Cell 31, 586 (2008). Dr. T. Oka: J. Biochem. 143, 449 (2008). Dr. H. Sawa: normal embryonic cell division.
Mutation site26031/26032-GTTCAGCCACATTG-26450/26451 (419 bp deletion + 14 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(24019..24100, 24149..24283, 24330..24800, 24846..24957, 25007..26114, 26166..26383, 26435..26560, 26607..26679))
Map position-0.87
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCTGTCTGCTCACGGTAA,IntFwd:GTCCTGGTGGATTCGTTTAG,ExtRev:CTCATTGCATGTACGGTGTA,IntRev:GAACGGGGGCTTGCTGATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tan FJ, Husain M, Manlandro CM, Koppenol M, Fire AZ, Hill RB.
CED-9 and mitochondrial homeostasis in C. elegans muscle.
J. Cell. Sci. 2008 121(Pt 20) 3373-82 
[ PubMed ID = 18827010 ] [ RRC reference ]

Yu Y, Mutlu AS, Liu H, Wang MC.
High-throughput screens using photo-highlighting discover BMP signaling in mitochondrial lipid oxidation.
Nat Commun 2017 8(1) 865 
[ PubMed ID = 29021566 ] [ RRC reference ]

Yasuda K, Hartman PS, Ishii T, Suda H, Akatsuka A, Shoyama T, Miyazawa M, Ishii N.
Interrelationships between mitochondrial fusion, energy metabolism and oxidative stress during development in Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2011 404(3) 751-5 
[ PubMed ID = 21144829 ] [ RRC reference ]

Kanazawa T, Zappaterra MD, Hasegawa A, Wright AP, Newman-Smith ED, Buttle KF, McDonald K, Mannella CA, van der Bliek AM.
The C. elegans Opa1 homologue EAT-3 is essential for resistance to free radicals.
PLoS Genet. 2008 4(2) e1000022 
[ PubMed ID = 18454199 ] [ RRC reference ]

Köhler F, Müller-Rischart AK, Conradt B, Rolland SG.
The loss of LRPPRC function induces the mitochondrial unfolded protein response.
Aging (Albany NY) 2015 7(9) 701-17 
[ PubMed ID = 26412102 ] [ RRC reference ]

Ackema KB, Hench J, Böckler S, Wang SC, Sauder U, Mergentaler H, Westermann B, Bard F, Frank S, Spang A.
The small GTPase Arf1 modulates mitochondrial morphology and function.
EMBO J. 2014 33(22) 2659-75 
[ PubMed ID = 25190516 ] [ RRC reference ]

Johnson D, Allman E, Nehrke K.
Regulation of acid-base transporters by reactive oxygen species following mitochondrial fragmentation.
Am. J. Physiol., Cell Physiol. 2012 302(7) C1045-54 
[ PubMed ID = 22237403 ] [ RRC reference ]

Breckenridge DG, Kang BH, Xue D.
Bcl-2 proteins EGL-1 and CED-9 do not regulate mitochondrial fission or fusion in Caenorhabditis elegans.
Curr. Biol. 2009 19(9) 768-73 
[ PubMed ID = 19327994 ] [ RRC reference ]

Rolland SG, Lu Y, David CN, Conradt B.
The BCL-2-like protein CED-9 of C. elegans promotes FZO-1/Mfn1,2- and EAT-3/Opa1-dependent mitochondrial fusion.
J. Cell Biol. 2009 186(4) 525-40 
[ PubMed ID = 19704021 ] [ RRC reference ]

Jiang HC, Hsu JM, Yen CP, Chao CC, Chen RH, Pan CL.
Neural activity and CaMKII protect mitochondria from fragmentation in aging Caenorhabditis elegans neurons.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(28) 8768-73 
[ PubMed ID = 26124107 ] [ RRC reference ]

Johnson D, Nehrke K.
Mitochondrial fragmentation leads to intracellular acidification in Caenorhabditis elegans and mammalian cells.
Mol. Biol. Cell 2010 21(13) 2191-201 
[ PubMed ID = 20444981 ] [ RRC reference ]

Luz AL, Godebo TR, Smith LL, Leuthner TC, Maurer LL, Meyer JN.
Deficiencies in mitochondrial dynamics sensitize Caenorhabditis elegans to arsenite and other mitochondrial toxicants by reducing mitochondrial adaptability.
Toxicology 2017 387 81-94 
[ PubMed ID = 28602540 ] [ RRC reference ]

Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, Laboy R, Hirschey MD, Mair WB.
Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling.
Cell Metab. 2017 26(6) 884-896.e5 
[ PubMed ID = 29107506 ] [ RRC reference ]

Luz AL, Rooney JP, Kubik LL, Gonzalez CP, Song DH, Meyer JN.
Mitochondrial Morphology and Fundamental Parameters of the Mitochondrial Respiratory Chain Are Altered in Caenorhabditis elegans Strains Deficient in Mitochondrial Dynamics and Homeostasis Processes.
PLoS ONE 2015 10(6) e0130940 
[ PubMed ID = 26106885 ] [ RRC reference ]

Rolland SG, Motori E, Memar N, Hench J, Frank S, Winklhofer KF, Conradt B.
Impaired complex IV activity in response to loss of LRPPRC function can be compensated by mitochondrial hyperfusion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(32) E2967-76 
[ PubMed ID = 23878239 ] [ RRC reference ]

Bess AS, Crocker TL, Ryde IT, Meyer JN.
Mitochondrial dynamics and autophagy aid in removal of persistent mitochondrial DNA damage in Caenorhabditis elegans.
Nucleic Acids Res. 2012 40(16) 7916-31 
[ PubMed ID = 22718972 ] [ RRC reference ]

Ohba Y, Sakuragi T, Kage-Nakadai E, Tomioka NH, Kono N, Imae R, Inoue A, Aoki J, Ishihara N, Inoue T, Mitani S, Arai H.
Mitochondria-type GPAT is required for mitochondrial fusion.
EMBO J. 2013 32(9) 1265-79 
[ PubMed ID = 23572076 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet. 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Breckenridge DG, Kang BH, Kokel D, Mitani S, Staehelin LA, Xue D.
Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9.
Mol. Cell 2008 31(4) 586-97 
[ PubMed ID = 18722182 ] [ RRC reference ]

Lin CJ, Wang MC.
Microbial metabolites regulate host lipid metabolism through NR5A-Hedgehog signalling.
Nat. Cell Biol. 2017 19(5) 550-557 
[ PubMed ID = 28436966 ] [ RRC reference ]