分離済み変異体

tm1133

Allele Nametm1133
Allele Type通常株
Sequence NameZK1248.14
Gene Namefzo-1
Worm BaseAllele Name tm1133
Gene Name fzo-1
Sequence ZK1248.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J-C. Martinou: not hypersensitive to anoxia, a bit slow growth at 20 degree. Dr. Xue: Mol Cell 31, 586 (2008). Dr. T. Oka: J. Biochem. 143, 449 (2008). Dr. H. Sawa: normal embryonic cell division.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26031/26032-GTTCAGCCACATTG-26450/26451 (419 bp deletion + 14 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(24019..24100, 24149..24283, 24330..24800, 24846..24957, 25007..26114, 26166..26383, 26435..26560, 26607..26679))
Map position-0.87
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCTGTCTGCTCACGGTAA,IntFwd:GTCCTGGTGGATTCGTTTAG,ExtRev:CTCATTGCATGTACGGTGTA,IntRev:GAACGGGGGCTTGCTGATTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Michaeli L, Spector E, Haeussler S, Carvalho CA, Grobe H, Abu-Shach UB, Zinger H, Conradt B, Broday L.
ULP-2 SUMO protease regulates UPRmt and mitochondrial homeostasis in Caenorhabditis elegans.
Free Radic Biol Med 2024 214 19-27 
[ PubMed ID = 38301974 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702 
[ PubMed ID = 38402241 ] [ RRC reference ]

Ren X, Zhou H, Sun Y, Fu H, Ran Y, Yang B, Yang F, Bjorklund M, Xu S.
MIRO-1 interacts with VDAC-1 to regulate mitochondrial membrane potential in Caenorhabditis elegans.
EMBO Rep 2023 24(8) e56297 
[ PubMed ID = 37306041 ] [ RRC reference ]

Zhang R, Fang J, Qi T, Zhu S, Yao L, Fang G, Li Y, Zang X, Xu W, Hao W, Liu S, Yang D, Chen D, Yang J, Ma X, Wu L.
Maternal aging increases offspring adult body size via transmission of donut-shaped mitochondria.
Cell Res 2023 33(11) 821-834 
[ PubMed ID = 37500768 ] [ RRC reference ]

Rolland S, Conradt B.
Genetic screen identifies non-mitochondrial proteins involved in the maintenance of mitochondrial homeostasis.
MicroPubl Biol 2022 2022  
[ PubMed ID = 35622507 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400 
[ PubMed ID = 36126046 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120 
[ PubMed ID = 36595699 ] [ RRC reference ]

Meshnik L, Bar-Yaacov D, Kasztan D, Neiger T, Cohen T, Kishner M, Valenci I, Dadon S, Klein CJ, Vance JM, Nevo Y, Züchner S, Ovadia O, Mishmar D, Ben-Zvi A.
Mutant C. elegans mitofusin leads to selective removal of mtDNA heteroplasmic deletions across generations to maintain fitness.
BMC Biol 2022 20(1) 40 
[ PubMed ID = 35139855 ] [ RRC reference ]

Chung KW, Kim JS, Lee KS.
A Database of Caenorhabditis elegans Locomotion and Body Posture Phenotypes for the Peripheral Neuropathy Model.
Mol Cells 2020 43(10) 880-888 
[ PubMed ID = 33115980 ] [ RRC reference ]

Liu YJ, McIntyre RL, Janssens GE, Williams EG, Lan J, van Weeghel M, Schomakers B, van der Veen H, van der Wel NN, Yao P, Mair WB, Aebersold R, MacInnes AW, Houtkooper RH.
Mitochondrial translation and dynamics synergistically extend lifespan in C. elegans through HLH-30.
J Cell Biol 2020 219(6)  
[ PubMed ID = 32259199 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Zhang Y, Lanjuin A, Chowdhury SR, Mistry M, Silva-García CG, Weir HJ, Lee CL, Escoubas CC, Tabakovic E, Mair WB.
Neuronal TORC1 modulates longevity via AMPK and cell nonautonomous regulation of mitochondrial dynamics in C. elegans.
Elife 2019 8  
[ PubMed ID = 31411562 ] [ RRC reference ]

Pryor R, Norvaisas P, Marinos G, Best L, Thingholm LB, Quintaneiro LM, De Haes W, Esser D, Waschina S, Lujan C, Smith RL, Scott TA, Martinez-Martinez D, Woodward O, Bryson K, Laudes M, Lieb W, Houtkooper RH, Franke A, Temmerman L, Bjedov I, Cochemé HM, Kaleta C, Cabreiro F.
Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy.
Cell 2019 178(6) 1299-1312.e29 
[ PubMed ID = 31474368 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc Natl Acad Sci U S A 2019 116(43) 21651-21658 
[ PubMed ID = 31591219 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050 
[ PubMed ID = 32103012 ] [ RRC reference ]

Charmpilas N, Tavernarakis N.
Mitochondrial maturation drives germline stem cell differentiation in Caenorhabditis elegans.
Cell Death Differ 2020 27(2) 601-617 
[ PubMed ID = 31217501 ] [ RRC reference ]

Zhou J, Wang X, Wang M, Chang Y, Zhang F, Ban Z, Tang R, Gan Q, Wu S, Guo Y, Zhang Q, Wang F, Zhao L, Jing Y, Qian W, Wang G, Guo W, Yang C.
The lysine catabolite saccharopine impairs development by disrupting mitochondrial homeostasis.
J Cell Biol 2019 218(2) 580-597 
[ PubMed ID = 30573525 ] [ RRC reference ]