分離済み変異体

tm11324

Allele Nametm11324
BalanceNot Required
OutCrossRequest Available
Sequence NameY27F2A.2 Y27F2A.1 Y27F2A.11 Y27F2A.9 ZC239.7 ZC239.8 ZC239.9 ZC239.10 ZC239.19 ZC239.20 ZC239.12 ZC239.6 ZC239.5
Gene NameY27F2A.2 Y27F2A.1 Y27F2A.11 Y27F2A.9 ZC239.7 ZC239.8 ZC239.9 ZC239.10 ZC239.19 ZC239.20 ZC239.12 ZC239.6 ZC239.5
Worm BaseAllele Name tm11324
Gene Name Y27F2A.2 Y27F2A.1 Y27F2A.11 Y27F2A.9 ZC239.7 ZC239.8 ZC239.9 ZC239.10 ZC239.19 ZC239.20 ZC239.12 ZC239.6 ZC239.5
Sequence Y27F2A.2 Y27F2A.1 Y27F2A.11 Y27F2A.9 ZC239.7 ZC239.8 ZC239.9 ZC239.10 ZC239.19 ZC239.20 ZC239.12 ZC239.6 ZC239.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y27F2A]32172/32173-[ZC239]20991/20992 (27263 bp deletion)
ChromosomeII
Putative gene structureY27F2A.2 = join(31255..31404, 31455..31583, 31628..31846, 32298..32610, 32659..32776, 32824..32887); Y27F2A.1 = join(33383..33532, 33603..33731, 33781..33999, 34335..34647, 34700..34817, 34862..34925); Y27F2A.11 Y27F2A.9 = complement(join(37423..37536, 37585..37707)); ZC239.7 = complement(join(73..302, 468..567, 613..705, 754..936, 987..1110, 1159..1299, 1343..1529, 1577..2360, 2403..2544, 2602..3089, 3867..4033, 4078..4179, 4223..4328, 4373..4528)); ZC239.8 = complement(join(5266..5320, 5364..5463, 5514..5826, 6154..6372, 6421..6549, 6599..6751)); ZC239.9 = complement(join(7271..7334, 7380..7479, 7534..7846, 7892..8110, 8230..8358, 8407..8559)); ZC239.10 = complement(join(8857..8911, 8959..9058, 9111..9423, 9670..9888, 9946..10074, 10120..10272)); ZC239.19 = join(11368..11520, 11569..11697, 11746..11964, 12732..13044, 13093..13196); ZC239.20 ZC239.12 = complement(join(15521..15708, 15757..15890, 15941..16233, 16285..16404)); ZC239.6 = join(17317..17418, 17468..17725, 17777..17912, 17965..18245); ZC239.5 = join(20024..20137, 20190..20420, 20468..20525, 20594..20805)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:CGAACACGCAGTCCTCCAAG,ExtFwd:TTGAAGAGGTGTGTGAGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication