Home > Mutants (Isolated) > tm11231

Mutants (Isolated)

tm11231

Allele Nametm11231
BalanceRequest Available
OutCrossRequest Available
Sequence NameY45F10D.3 Y45F10D.11 Y45F10D.4 Y45F10D.10 Y45F10D.9 Y45F10D.7
Gene NameY45F10D.3 Y45F10D.11 Y45F10D.4 Y45F10D.10 Y45F10D.9 Y45F10D.7
Worm BaseAllele Name tm11231
Gene Name Y45F10D.3 Y45F10D.11 Y45F10D.4 Y45F10D.10 Y45F10D.9 Y45F10D.7
Sequence Y45F10D.3 Y45F10D.11 Y45F10D.4 Y45F10D.10 Y45F10D.9 Y45F10D.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20591/20592-33093/33094 (12502 bp deletion)
ChromosomeIV
Putative gene structureY45F10D.3 = join(19340..19522, 19580..19730, 19784..19875, 19925..20032, 20085..20240, 20304..20479, 21032..21997, 22240..22462); Y45F10D.11 = complement(join(22687..22855, 22905..23186, 23243..23541, 24928..25038, 25086..25298, 25739..25888)); Y45F10D.4 = join(24218..24307, 24366..24485, 24549..24732, 24787..24854); Y45F10D.10 = complement(join(26034..26108, 26164..26263, 26358..26479, 26841..26966, 27027..27071)); Y45F10D.9 = complement(join(27246..27389, 27520..28420, 28474..28824, 28870..28952)); Y45F10D.7 = join(29351..29413, 29461..29624, 29670..30158, 30218..30286, 31115..31429, 32848..33433, 34623..35269, 36006..36366)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:CTAGCAACTCGATGACACAC,ExtFwd:TGCCACCTCGAATGACGGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication