Home > Mutants (Isolated) > tm11228

Mutants (Isolated)

tm11228

Allele Nametm11228
BalanceNot Required
OutCrossRequest Available
Sequence NameT06A1.4 T06A1.2 T06A1.9 T06A1.6 T06A1.7 Y40B10B.1 Y40B10B.2 Y40B10B.3 T08B1.6
Gene NameT06A1.4 T06A1.2 T06A1.9 T06A1.6 T06A1.7 Y40B10B.1 Y40B10B.2 Y40B10B.3 T08B1.6
Worm BaseAllele Name tm11228
Gene Name T06A1.4 T06A1.2 T06A1.9 T06A1.6 T06A1.7 Y40B10B.1 Y40B10B.2 Y40B10B.3 T08B1.6
Sequence T06A1.4 T06A1.2 T06A1.9 T06A1.6 T06A1.7 Y40B10B.1 Y40B10B.2 Y40B10B.3 T08B1.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T06A1]27318/27319-[T08B1]4110/4111 (20918 bp deletion)
ChromosomeV
Putative gene structureT06A1.4 = join(21932..22038, 22399..22476, 23789..23936); T06A1.2 = complement(join(30888..31238, 32266..32367, 32486..32690, 32741..32847, 33184..33249, 33345..33536)); T06A1.9 T06A1.6 = complement(31664..32206); T06A1.7 Y40B10B.1 = complement(join(187..303, 386..522, 594..698, 748..1173, 1225..1453)); Y40B10B.2 = complement(join(2865..3224, 3768..3869,4001..4205, 4256..4362, 4651..4716, 4765..4956)); Y40B10B.3 T08B1.6
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:ATGAGTGTGGCAGTGTTACC,ExtFwd:GAACCTTTGACGGCTCCTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication