分離済み変異体

tm11213

Allele Nametm11213
BalanceNot Required
OutCrossRequest Available
Sequence NameY38H8A.1 Y38H8A.10 Y38H8A.11 Y45F10A.6 Y45F10A.7 Y45F10A.5 Y45F10A.4 Y45F10A.3 Y45F10A.2 F52G2.1
Gene NameY38H8A.1 Y38H8A.10 Y38H8A.11 Y45F10A.6 Y45F10A.7 Y45F10A.5 Y45F10A.4 Y45F10A.3 Y45F10A.2 F52G2.1
Worm BaseAllele Name tm11213
Gene Name Y38H8A.1 Y38H8A.10 Y38H8A.11 Y45F10A.6 Y45F10A.7 Y45F10A.5 Y45F10A.4 Y45F10A.3 Y45F10A.2 F52G2.1
Sequence Y38H8A.1 Y38H8A.10 Y38H8A.11 Y45F10A.6 Y45F10A.7 Y45F10A.5 Y45F10A.4 Y45F10A.3 Y45F10A.2 F52G2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y38H8A]30507/30508-GG-[F52G2]6425/6426 (37128 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structureY38H8A.1 = join(28884..29349,29591..29786,30591..30747); Y38H8A.10 Y38H8A.11 Y45F10A.6 = complement(join(AL021483.1:22449..22488, AL021483.1:23330..23452, AL021483.1:23495..23900, AL021483.1:24987..25149, AL021483.1:25758..26172, AL021483.1:27284..27393, AL021483.1:30864..31070, AL021483.1:32084..32329, AL021483.1:33252..34004, AL021483.1:34823..35068, 161..293, 8132..8275, 8326..8471, 9406..9539, 9594..9680, 11185..11280, 11340..11703)); Y45F10A.7 = join(2937..3098,3200..3298,3960..4217); Y45F10A.5 = complement(join(15766..15937, 15997..16076)); Y45F10A.4 = join(16445..16625, 17068..17321, 17920..18483, 19279..19416); Y45F10A.3 = join(19591..19830, 20368..20508, 20561..20639, 22907..23172); Y45F10A.2 = complement(join(20884..21253, 21301..22110, 22183..22511)); F52G2.1 = complement(join(AL021488.1:23985..24080, AL021488.1:24886..25574, 699..1258, 2382..2713, 2762..2938, 4410..4841, 5941..6084))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:TGACGCTTGCCAGAGGGTAG,ExtFwd:TGTGGTGGATAGTAGTGATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication