Home > Mutants (Isolated) > tm11200

Mutants (Isolated)

tm11200

Allele Nametm11200
BalanceNot Required
OutCrossRequest Available
Sequence NameT10A3.1 T10A3.2 T10A3.5 K03A1.9 K03A1.10 K03A1.2 K03A1.4 K03A1.8 K03A1.5
Gene NameT10A3.1 T10A3.2 T10A3.5 K03A1.9 K03A1.10 K03A1.2 K03A1.4 K03A1.8 K03A1.5
Worm BaseAllele Name tm11200
Gene Name T10A3.1 T10A3.2 T10A3.5 K03A1.9 K03A1.10 K03A1.2 K03A1.4 K03A1.8 K03A1.5
Sequence T10A3.1 T10A3.2 T10A3.5 K03A1.9 K03A1.10 K03A1.2 K03A1.4 K03A1.8 K03A1.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T10A3]9327/9328-[K03A1]24925/24926 (23545 bp deletion)
ChromosomeX
Putative gene structureT10A3.1 = complement(join(3794..3988, 4039..4178, 4231..4433, 4468..4621, 4672..4901, 5076..5390, 5564..5633, 5789..6392, 6446..6777, 6870..6983, 7030..7157, 7215..7338, 7387..7591, 7691..7974, 8028..8200, 8550..8649, 8709..8890, 8938..8993, 9201..9289, 9399..9543, 9601..9937, 10051..10238, 10653..10723, 10903..11036, 11096..11145, 11479..11547)); T10A3.2 T10A3.5 K03A1.9 K03A1.10 K03A1.2 = join(15437..15775, 16143..16199, 17029..17100, 17147..17263, 17310..17458, 17509..17652, 17696..17791, 17866..17958, 18006..18404, 18448..18543, 18625..18724, 19005..19103); K03A1.4 = complement(join(19651..19806, 19934..20043, 20303..20446, 20493..20532, 22407..22478, 23113..23198, 23486..23526, 23937..24019, 24589..24651)); K03A1.8 K03A1.5 = complement(join(25059..25184, 25231..25387, 25587..25896, 26444..26579, 26635..26735, 26797..26963, 27384..27568, 27612..27763, 27814..28137, 28185..28305, 28391..28494, 28649..28868))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:CAGTATCCAGGCAGCCATTG,ExtFwd:TGTTCATGGGCGTAGTTTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication