Home > Mutants (Isolated) > tm11192

Mutants (Isolated)

tm11192

Allele Nametm11192
BalanceCompleted
OutCrossCompleted
Sequence NameZK1290.5 ZK1290.12 ZK1290.8 ZK1290.21 ZK1290.13 ZK1290.4 ZK1290.3 ZK1290.20 ZK1290.9 ZK1290.2
Gene NameZK1290.5 ZK1290.12 ZK1290.8 ZK1290.21 ZK1290.13 ZK1290.4 ZK1290.3 ZK1290.20 ZK1290.9 ZK1290.2
Worm BaseAllele Name tm11192 (x1)
Gene Name ZK1290.5 ZK1290.12 ZK1290.8 ZK1290.21 ZK1290.13 ZK1290.4 ZK1290.3 ZK1290.20 ZK1290.9 ZK1290.2
Sequence ZK1290.5 ZK1290.12 ZK1290.8 ZK1290.21 ZK1290.13 ZK1290.4 ZK1290.3 ZK1290.20 ZK1290.9 ZK1290.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7601/7602-28747/28748 (21146 bp deletion)
ChromosomeII
Putative gene structureZK1290.5 = join(6339..6741, 6907..7310, 7362..7520); ZK1290.12 = join(7876..8073, 8417..8589, 8634..8804, 8851..9482, 9553..9833); ZK1290.8 = complement(join(10189..10275, 10327..10591, 10639..10874, 10951..11139)); ZK1290.21 ZK1290.13 = join(11876..11947, 11998..12091, 12535..12650, 12699..12796, 12846..12928, 12977..13113, 13365..13619); ZK1290.4 = join(14973..14990, 15393..15533, 15582..15656, 15712..15792, 15848..15946, 16002..16133, 16190..16544, 16960..17218, 17268..17563, 17606..17743, 18008..18140, 18188..18474, 18524..18615, 18852..18951, 19131..19231); ZK1290.3 = join(20827..20994, 21081..21876, 21927..21952); ZK1290.20 ZK1290.9 = complement(join(23513..23731, 23780..24168, 24240..24433, 24482..24565, 24622..24818)); ZK1290.2 = join(26080..26135, 26510..26609, 26650..27001, 27044..27147, 27189..27256, 27314..27403, 27455..27561, 27609..27744, 27791..27917, 27964..28232, 28310..28469)
Map position
BalancermIn1 [e128 mIs14]
Map position of balancer
Sequence of primersExtRev:ACCTGCCCGACATGTTAGAG,ExtFwd:TACTGTCCACTTGCCAAGGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication