Home > Mutants (Isolated) > tm11181

Mutants (Isolated)

tm11181

Allele Nametm11181
BalanceCompleted
OutCrossCompleted
Sequence NameT05E7.2 T05E7.5 T05E7.1 T08B2.7 T08B2.8 T08B2.9 T08B2.14 T08B2.13 T08B2.t1 T08B2.15 T08B2.5
Gene NameT05E7.2 T05E7.5 T05E7.1 T08B2.7 T08B2.8 T08B2.9 T08B2.14 T08B2.13 T08B2.t1 T08B2.15 T08B2.5
Worm BaseAllele Name tm11181 (x1)
Gene Name T05E7.2 T05E7.5 T05E7.1 T08B2.7 T08B2.8 T08B2.9 T08B2.14 T08B2.13 T08B2.t1 T08B2.15 T08B2.5
Sequence T05E7.2 T05E7.5 T05E7.1 T08B2.7 T08B2.8 T08B2.9 T08B2.14 T08B2.13 T08B2.t1 T08B2.15 T08B2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T05E7]9535/9536-[T08B2]9289/9290 (19143 bp deletion)
ChromosomeI
Putative gene structureT05E7.2 = join(11355..11431, 11802..11910, 11967..12407); T05E7.5 = complement(join(13239..14088, 14174..14290, 14382..14560)); T05E7.1 = join(16111..16325, 16504..16610, 16669..16774, 16822..17119, 17380..17721, 18700..18786, 18829..19098); T08B2.7 = complement(join(33..324, 439..962, 1009..1509, 1554..2294, 2359..2571, 2716..2764, 3907..3932)); T08B2.8 = complement(join(4187..4528, 4572..4709)); T08B2.9 = complement(join(4962..5162, 5207..5470, 5821..6005, 6058..6302, 6349..6441, 6492..6691, 6738..7041, 7138..7248, 7345..7400)); T08B2.14 T08B2.13 T08B2.t1 T08B2.15 T08B2.5 = join(8616..8672, 8744..8812, 8884..8993, 9184..9416, 9503..9618, 9948..10079, 10128..10277, 10325..10429, 10476..10593, 10643..10849, 10893..11009, 11055..11134, 11178..11340, 11389..11751, 11801..12081, 12141..12474, 12520..12662)
Map position
BalancertmC20[tmIs1219 tm9715]
Map position of balancer
Sequence of primersExtRev:CAGACGAAGGTGGTGAACGG,ExtFwd:GCGTCACCTACTCTTGAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication