Mutants (Isolated)

tm1117

Allele Nametm1117
Sequence NameY113G7A.11
CGC Namessu-1
Worm BaseAllele Name tm1117
CGC Name ssu-1
Sequence Y113G7A.11
Phenotypehomozygous viable. Dr. P. Morgan: mRNA is detectable. Dr. M. Chalfie: non-Mec.
Mutation site106694/106695-ANCCCC-106883/106884 (189 bp deletion + 6 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(101991..102237, 102614..102867, 104046..104419, 105449..105682, 106588..106717))
Map position24.82
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCGAGCCTACGCATTTGGA,IntFwd:ATGGGCGGAGCCTAAGTTAC,ExtRev:TCGCAGTTAGCTCCCACTAA,IntRev:CAATTAGTAGGCGGCGACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Burton NO, Dwivedi VK, Burkhart KB, Kaplan REW, Baugh LR, Horvitz HR.
Neurohormonal signaling via a sulfotransferase antagonizes insulin-like signaling to regulate a Caenorhabditis elegans stress response.
Nat Commun 2018 9(1) 5152 
[ PubMed ID = 30514845 ] [ RRC reference ]

Carroll BT, Dubyak GR, Sedensky MM, Morgan PG.
Sulfated signal from ASJ sensory neurons modulates stomatin-dependent coordination in Caenorhabditis elegans.
J Biol Chem 2006 281(47) 35989-96 
[ PubMed ID = 16973616 ] [ RRC reference ]