Mutants (Isolated)

tm1116

Allele Nametm1116
BalanceNot Required
OutCrossNot Accepted
Sequence NameR04A9.2
Gene Namenrde-3
Worm BaseAllele Name tm1116
Gene Name nrde-3
Sequence R04A9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 300/301-749/750 (449 bp deletion)
ChromosomeX
Putative gene structurejoin(585..843, 890..1067, 1117..1396, 1745..2355, 2408..2618, 2827..3155, 3203..3396, 3721..4126, 4173..4524, 4581..4771, 4820..4982)
Map position-20.06
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGCGATGAAGGAGGAGTCT,IntFwd:CCCCGATAACCGATCGATAC,ExtRev:ATCACGCGGTGAGCGTCTAT,IntRev:TCTACTGTTCCCGCCGCCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Knudsen-Palmer DR, Raman P, Ettefa F, De Ravin L, Jose AM.
Target-specific requirements for RNA interference can arise through restricted RNA amplification despite the lack of specialized pathways.
Elife 2024 13  
[ PubMed ID = 39161220 ] [ RRC reference ]

Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232 
[ PubMed ID = 37454110 ] [ RRC reference ]

Delaney CE, Methot SP, Kalck V, Seebacher J, Hess D, Gasser SM, Padeken J.
SETDB1-like MET-2 promotes transcriptional silencing and development independently of its H3K9me-associated catalytic activity.
Nat Struct Mol Biol 2022 29(2) 85-96 
[ PubMed ID = 35102319 ] [ RRC reference ]

Padeken J, Methot S, Zeller P, Delaney CE, Kalck V, Gasser SM.
Argonaute NRDE-3 and MBT domain protein LIN-61 redundantly recruit an H3K9me3 HMT to prevent embryonic lethality and transposon expression.
Genes Dev 2021 35(1-2) 82-101 
[ PubMed ID = 33303642 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol Cell Biol 2018 38(15)  
[ PubMed ID = 29760282 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Le HH, Looney M, Strauss B, Bloodgood M, Jose AM.
Tissue homogeneity requires inhibition of unequal gene silencing during development.
J Cell Biol 2016 214(3) 319-31 
[ PubMed ID = 27458132 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Bagijn MP, Goldstein LD, Sapetschnig A, Weick EM, Bouasker S, Lehrbach NJ, Simard MJ, Miska EA.
Function, targets, and evolution of Caenorhabditis elegans piRNAs.
Science 2012 337(6094) 574-578 
[ PubMed ID = 22700655 ] [ RRC reference ]



    
[ PubMed ID = 39902803 ] [ RRC reference ]