Home > Mutants (Isolated) > tm1116

Mutants (Isolated)

Allele Name		tm1116
Allele Type		Normal
Sequence Name		R04A9.2
Gene Name		nrde-3
Worm Base	Allele Name	tm1116
	Gene Name	nrde-3
	Sequence	R04A9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		300/301-749/750 (449 bp deletion)
Chromosome		X
Putative gene structure		join(585..843, 890..1067, 1117..1396, 1745..2355, 2408..2618, 2827..3155, 3203..3396, 3721..4126, 4173..4524, 4581..4771, 4820..4982)
Map position		-20.06
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CAGCGATGAAGGAGGAGTCT,IntFwd:CCCCGATAACCGATCGATAC,ExtRev:ATCACGCGGTGAGCGTCTAT,IntRev:TCTACTGTTCCCGCCGCCAT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A. Inheritance of associative memories and acquired cellular changes in C. elegans. Nat Commun 2023 14(1) 4232  [ PubMed ID = 37454110 ] [ RRC reference ] Delaney CE, Methot SP, Kalck V, Seebacher J, Hess D, Gasser SM, Padeken J. SETDB1-like MET-2 promotes transcriptional silencing and development independently of its H3K9me-associated catalytic activity. Nat Struct Mol Biol 2022 29(2) 85-96  [ PubMed ID = 35102319 ] [ RRC reference ] Padeken J, Methot S, Zeller P, Delaney CE, Kalck V, Gasser SM. Argonaute NRDE-3 and MBT domain protein LIN-61 redundantly recruit an H3K9me3 HMT to prevent embryonic lethality and transposon expression. Genes Dev 2021 35(1-2) 82-101  [ PubMed ID = 33303642 ] [ RRC reference ] Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD. The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2. Mol Cell Biol 2018 38(15)   [ PubMed ID = 29760282 ] [ RRC reference ] Le HH, Looney M, Strauss B, Bloodgood M, Jose AM. Tissue homogeneity requires inhibition of unequal gene silencing during development. J Cell Biol 2016 214(3) 319-31  [ PubMed ID = 27458132 ] [ RRC reference ] Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y. A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans. Neuron 2018 97(3) 511-519.e6  [ PubMed ID = 29395906 ] [ RRC reference ] Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A. Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans. mBio 2017 8(5)   [ PubMed ID = 29018118 ] [ RRC reference ] Hall SE, Chirn GW, Lau NC, Sengupta P. RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans. RNA 2013 19(3) 306-19  [ PubMed ID = 23329696 ] [ RRC reference ] Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S. Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans. Genetics 2014 197(1) 121-32  [ PubMed ID = 24532782 ] [ RRC reference ] Bagijn MP, Goldstein LD, Sapetschnig A, Weick EM, Bouasker S, Lehrbach NJ, Simard MJ, Miska EA. Function, targets, and evolution of Caenorhabditis elegans piRNAs. Science 2012 337(6094) 574-578  [ PubMed ID = 22700655 ] [ RRC reference ]