Mutants (Isolated)

tm1116

Allele Nametm1116
Sequence NameR04A9.2
CGC Namenrde-3
Worm BaseAllele Name tm1116
CGC Name nrde-3
Sequence R04A9.2
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site300/301-749/750 (449 bp deletion)
ChromosomeX
Putative gene structurejoin(585..843, 890..1067, 1117..1396, 1745..2355, 2408..2618, 2827..3155, 3203..3396, 3721..4126, 4173..4524, 4581..4771, 4820..4982)
Map position-20.06
Balancer
Map position of balancer
Sequence of primersIntRev:TCTACTGTTCCCGCCGCCAT,ExtFwd:CAGCGATGAAGGAGGAGTCT,ExtRev:ATCACGCGGTGAGCGTCTAT,IntFwd:CCCCGATAACCGATCGATAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Bagijn MP, Goldstein LD, Sapetschnig A, Weick EM, Bouasker S, Lehrbach NJ, Simard MJ, Miska EA.
Function, targets, and evolution of Caenorhabditis elegans piRNAs.
Science 2012 337(6094) 574-578 
[ PubMed ID = 22700655 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]