分離済み変異体

tm11143

Allele Nametm11143
BalanceRequest Available
OutCrossRequest Available
Sequence NameY59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8 F54A3.11 F54A3.3
Gene NameY59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8 F54A3.11 F54A3.3
Worm BaseAllele Name tm11143
Gene Name Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8 F54A3.11 F54A3.3
Sequence Y59C2A.3 F54A3.4 F54A3.10 F54A3.5 F54A3.6 F54A3.9 F54A3.8 F54A3.11 F54A3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y59C2A]16563/16564-[F54A3]21957/21958 (24207 bp deletion)
ChromosomeII
Putative gene structureY59C2A.3 = complement(join(15142..15753, 16110..16553, 16883..17251, 17414..17809, 18453..18779)); F54A3.4 = complement(join(806..1088, 1274..1318, 1485..1876, 1921..2372, 2566..2672, 2717..3519, 4115..4182, 4229..4346)); F54A3.5 = complement(join(5291..5464, 6369..6512)); F54A3.6 = complement(join(6711..6830, 7744..8077, 9999..10246, 11217..11348, 11481..11570, 11635..11673, 12275..12343, 12499..12567, 12615..12684, 12728..12782, 12850..12985, 13035..13063, 13116..13137)); F54A3.3 =join(14355..14453, 14508..14617, 16269..16658, 17784..17952, 18920..19315, 21166..21471, 22458..22535, 23301..23384)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:ACTTGAATACGGACGGCCAG,ExtFwd:TGATACCTGGCTCTATCCGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication