Home > Mutants (Isolated) > tm11138

Mutants (Isolated)

tm11138

Allele Nametm11138
BalanceNot Required
OutCrossCompleted
Sequence NameF39B1.1 F39B1.4 F39B1.t2 F46F2.8 F46F2.t1 F46F2.11 F46F2.1 F46F2.4 F46F2.3
Gene NameF39B1.1 F39B1.4 F39B1.t2 F46F2.8 F46F2.t1 F46F2.11 F46F2.1 F46F2.4 F46F2.3
Worm BaseAllele Name tm11138 (x1)
Gene Name F39B1.1 F39B1.4 F39B1.t2 F46F2.8 F46F2.t1 F46F2.11 F46F2.1 F46F2.4 F46F2.3
Sequence F39B1.1 F39B1.4 F39B1.t2 F46F2.8 F46F2.t1 F46F2.11 F46F2.1 F46F2.4 F46F2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F39B1]9674/9675-[F46F2]20310/20311 (24399 bp deletion)
ChromosomeX
Putative gene structureF39B1.1 = complement(join(6892..7089, 7166..7311, 7366..7516, 9378..9513, 9564..9664, 9715..9790, 9998..10242, 10294..10450, 10501..10937, 11183..11768, 11854..12300, 12347..12507, 12558..13006, 13432..13550, 13603..13766, Z69903.1:269..398, Z69903.1:1618..1846, Z69903.1:1891..1999, Z69903.1:2880..3094, Z69903.1:3301..3468, Z69903.1:3599..3804, Z69903.1:4079..4228, Z69903.1:4329..4372)); F39B1.4 F39B1.t2 = complement(13125..13197); F46F2.8 F46F2.t1 = 6980..7050; F46F2.11 F46F2.1 = join(8816..9076, 9668..10863, 10923..11009, 11060..11143, 11188..11884); F46F2.4 = join(15604..15727, 15772..15847, 16073..16136, 16188..17018); F46F2.3 = complement(join(17761..17946, 18031..18258))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:AGGGCGGTTACTGCTATCAC,ExtFwd:TGGATAATCCGCTTCTGGGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication