Home > Mutants (Isolated) > tm11121

Mutants (Isolated)

tm11121

Allele Nametm11121
BalanceNot Required
OutCrossRequest Available
Sequence NameZK783.2 ZK783.8 ZK783.t1 ZK783.5 ZK783.3 ZK783.6 ZK783.4 ZK783.7 C18H2.7 C18H2.1
Gene NameZK783.2 ZK783.8 ZK783.t1 ZK783.5 ZK783.3 ZK783.6 ZK783.4 ZK783.7 C18H2.7 C18H2.1
Worm BaseAllele Name tm11121
Gene Name ZK783.2 ZK783.8 ZK783.t1 ZK783.5 ZK783.3 ZK783.6 ZK783.4 ZK783.7 C18H2.7 C18H2.1
Sequence ZK783.2 ZK783.8 ZK783.t1 ZK783.5 ZK783.3 ZK783.6 ZK783.4 ZK783.7 C18H2.7 C18H2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [ZK783]15773/15774-[C18H2]13334/13335 (30347 bp deletion)
ChromosomeIII
Putative gene structureZK783.2 = complement(join(15401..15490, 15538..16053, 16101..16244, 17128..17265)); ZK783.t1 = complement(16332..16403); ZK783.5 = complement(join(20350..20466, 20513..20614, 20660..20863, 20909..21160)); ZK783.3 = complement(join(21326..21362, 21409..21505, 21556..21853, 21905..21995, 22133..22245)); ZK783.4 = complement(join(24989..25169, 25466..26067, 26337..26558, 26601..27012, 27144..28079, 28127..28265, 28314..28833, 29009..29383, 29436..30179)); C18H2.1 = join(2692..3040, 3586..3706, 4136..4350, 4432..5414, 5457..5712, 5761..6700, 7270..7444, 7492..7606, 7706..8031, 8079..8394, 8550..8689, 8737..8862, 9164..9248, 9548..9861, 11033..11312, 11975..12055, 12625..12726, 12802..12933, 13074..13157, 13205..13251, 13342..13427, 13490..13541)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:TGTTCTCGGCAGTTCGCTCC,ExtFwd:ACCTGATCTCCATCCATACG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication