Mutants (Isolated)

tm1109

Allele Nametm1109
BalanceCompleted
OutCrossNot Accepted
Sequence NameT14G10.1
Gene Namepps-1
Worm BaseAllele Name tm1109 (x1)
Gene Name pps-1
Sequence T14G10.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16080/16081-CCTATCTCT-16448/16449 (368 bp deletion + 9 bp insertion)
ChromosomeIV
Putative gene structurejoin(16087..16155, 16221..16397, 16449..16728, 16777..17854, 17907..18170, 18222..18312)
Map position4.55
Balancermec-3 (e1338) IV
Map position of balancer
Sequence of primersExtFwd:CCGCCTACCACTTCTTAGTA,IntFwd:TGCCCACGTATCATATGCTG,ExtRev:CCGTGCCAATCCTCGCATCT,IntRev:AGCAGGATCACGTCCCACTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Dejima K, Seko A, Yamashita K, Gengyo-Ando K, Mitani S, Izumikawa T, Kitagawa H, Sugahara K, Mizuguchi S, Nomura K.
Essential roles of 3'-phosphoadenosine 5'-phosphosulfate synthase in embryonic and larval development of the nematode Caenorhabditis elegans.
J Biol Chem 2006 281(16) 11431-40 
[ PubMed ID = 16497669 ] [ RRC reference ]