Mutants (Isolated)

tm1108

Allele Nametm1108
Allele TypeNormal
Sequence NameT12E12.4
Gene Namedrp-1
Worm BaseAllele Name tm1108
Gene Name drp-1
Sequence T12E12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)
ChromosomeIV
Putative gene structurejoin(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)
Map position1.82
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guha S, Cheng A, Carroll T, King D, Koren SA, Swords S, Nehrke K, Johnson GVW.
Selective disruption of Drp1-independent mitophagy and mitolysosome trafficking by an Alzheimer's disease relevant tau modification in a novel Caenorhabditis elegans model.
Genetics 2022 222(1)  
[ PubMed ID = 35916724 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400 
[ PubMed ID = 36126046 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120 
[ PubMed ID = 36595699 ] [ RRC reference ]

Aman Y, Erinjeri AP, Tataridas-Pallas N, Williams R, Wellman R, Chapman H, Labbadia J.
Loss of MTCH-1 suppresses age-related proteostasis collapse through the inhibition of programmed cell death factors.
Cell Rep 2022 41(8) 111690 
[ PubMed ID = 36417880 ] [ RRC reference ]

Traa A, Machiela E, Rudich PD, Soo SK, Senchuk MM, Van Raamsdonk JM.
Identification of Novel Therapeutic Targets for Polyglutamine Diseases That Target Mitochondrial Fragmentation.
Int J Mol Sci 2021 22(24)  
[ PubMed ID = 34948242 ] [ RRC reference ]

Ma T, Zhao L, Zhang J, Tang R, Wang X, Liu N, Zhang Q, Wang F, Li M, Shan Q, Yang Y, Yin Q, Yang L, Gan Q, Yang C.
A pair of transporters controls mitochondrial Zn2+ levels to maintain mitochondrial homeostasis.
Protein Cell 2022 13(3) 180-202 
[ PubMed ID = 34687432 ] [ RRC reference ]

Gitschlag BL, Tate AT, Patel MR.
Nutrient status shapes selfish mitochondrial genome dynamics across different levels of selection.
Elife 2020 9  
[ PubMed ID = 32959778 ] [ RRC reference ]

Zheng F, Chen P, Li H, Aschner M.
Drp-1-Dependent Mitochondrial Fragmentation Contributes to Cobalt Chloride-Induced Toxicity in Caenorhabditis elegans.
Toxicol Sci 2020 177(1) 158-167 
[ PubMed ID = 32617571 ] [ RRC reference ]

Liu YJ, McIntyre RL, Janssens GE, Williams EG, Lan J, van Weeghel M, Schomakers B, van der Veen H, van der Wel NN, Yao P, Mair WB, Aebersold R, MacInnes AW, Houtkooper RH.
Mitochondrial translation and dynamics synergistically extend lifespan in C. elegans through HLH-30.
J Cell Biol 2020 219(6)  
[ PubMed ID = 32259199 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Shin MG, Lee JW, Han JS, Lee B, Jeong JH, Park SH, Kim JH, Jang S, Park M, Kim SY, Kim S, Yang YR, Kim JY, Hoe KL, Park C, Lee KP, Kwon KS, Kwon ES.
Bacteria-derived metabolite, methylglyoxal, modulates the longevity of C. elegans through TORC2/SGK-1/DAF-16 signaling.
Proc Natl Acad Sci U S A 2020 117(29) 17142-17150 
[ PubMed ID = 32636256 ] [ RRC reference ]

Wei W, Ruvkun G.
Lysosomal activity regulates Caenorhabditis elegans mitochondrial dynamics through vitamin B12 metabolism.
Proc Natl Acad Sci U S A 2020 117(33) 19970-19981 
[ PubMed ID = 32737159 ] [ RRC reference ]

Zhang Y, Lanjuin A, Chowdhury SR, Mistry M, Silva-García CG, Weir HJ, Lee CL, Escoubas CC, Tabakovic E, Mair WB.
Neuronal TORC1 modulates longevity via AMPK and cell nonautonomous regulation of mitochondrial dynamics in C. elegans.
Elife 2019 8  
[ PubMed ID = 31411562 ] [ RRC reference ]

Yen CA, Ruter DL, Turner CD, Pang S, Curran SP.
Loss of flavin adenine dinucleotide (FAD) impairs sperm function and male reproductive advantage in C. elegans.
Elife 2020 9  
[ PubMed ID = 32022684 ] [ RRC reference ]

Pryor R, Norvaisas P, Marinos G, Best L, Thingholm LB, Quintaneiro LM, De Haes W, Esser D, Waschina S, Lujan C, Smith RL, Scott TA, Martinez-Martinez D, Woodward O, Bryson K, Laudes M, Lieb W, Houtkooper RH, Franke A, Temmerman L, Bjedov I, Cochemé HM, Kaleta C, Cabreiro F.
Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy.
Cell 2019 178(6) 1299-1312.e29 
[ PubMed ID = 31474368 ] [ RRC reference ]

Lan J, Rollins JA, Zang X, Wu D, Zou L, Wang Z, Ye C, Wu Z, Kapahi P, Rogers AN, Chen D.
Translational Regulation of Non-autonomous Mitochondrial Stress Response Promotes Longevity.
Cell Rep 2019 28(4) 1050-1062.e6 
[ PubMed ID = 31340143 ] [ RRC reference ]

Kim S, Sieburth D.
A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans.
Genetics 2019 211(4) 1283-1295 
[ PubMed ID = 30782598 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]