Mutants (Isolated)

tm1108

Allele Nametm1108
Sequence NameT12E12.4
CGC Namedrp-1
Worm BaseAllele Name tm1108
CGC Name drp-1
Sequence T12E12.4
Phenotypehomozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.
Mutation site1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)
ChromosomeIV
Putative gene structurejoin(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)
Map position1.82
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Byrne JJ, Soh MS, Chandhok G, Vijayaraghavan T, Teoh JS, Crawford S, Cobham AE, Yapa NMB, Mirth CK, Neumann B.
Disruption of mitochondrial dynamics affects behaviour and lifespan in Caenorhabditis elegans.
Cell. Mol. Life Sci. 2019 76(10) 1967-1985 
[ PubMed ID = 30840087 ] [ RRC reference ]

Zhao YG, Chen Y, Miao G, Zhao H, Qu W, Li D, Wang Z, Liu N, Li L, Chen S, Liu P, Feng D, Zhang H.
The ER-Localized Transmembrane Protein EPG-3/VMP1 Regulates SERCA Activity to Control ER-Isolation Membrane Contacts for Autophagosome Formation.
Mol. Cell 2017 67(6) 974-989.e6 
[ PubMed ID = 28890335 ] [ RRC reference ]

Abdelwahid E, Rolland S, Teng X, Conradt B, Hardwick JM, White K.
Mitochondrial involvement in cell death of non-mammalian eukaryotes.
Biochim. Biophys. Acta 2011 1813(4) 597-607 
[ PubMed ID = 20950655 ] [ RRC reference ]

Regmi SG, Rolland SG, Conradt B.
Age-dependent changes in mitochondrial morphology and volume are not predictors of lifespan.
Aging (Albany NY) 2014 6(2) 118-30 
[ PubMed ID = 24642473 ] [ RRC reference ]

Lu Y, Rolland SG, Conradt B.
A molecular switch that governs mitochondrial fusion and fission mediated by the BCL2-like protein CED-9 of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(41) E813-22 
[ PubMed ID = 21949250 ] [ RRC reference ]

Yang CC, Chen D, Lee SS, Walter L.
The dynamin-related protein DRP-1 and the insulin signaling pathway cooperate to modulate Caenorhabditis elegans longevity.
Aging Cell 2011 10(4) 724-8 
[ PubMed ID = 21463460 ] [ RRC reference ]

Earls LR, Hacker ML, Watson JD, Miller DM 3rd.
Coenzyme Q protects Caenorhabditis elegans GABA neurons from calcium-dependent degeneration.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(32) 14460-5 
[ PubMed ID = 20663955 ] [ RRC reference ]

Scholtes C, Bellemin S, Martin E, Carre-Pierrat M, Mollereau B, Gieseler K, Walter L.
DRP-1-mediated apoptosis induces muscle degeneration in dystrophin mutants.
Sci Rep 2018 8(1) 7354 
[ PubMed ID = 29743663 ] [ RRC reference ]

Ackema KB, Hench J, Böckler S, Wang SC, Sauder U, Mergentaler H, Westermann B, Bard F, Frank S, Spang A.
The small GTPase Arf1 modulates mitochondrial morphology and function.
EMBO J. 2014 33(22) 2659-75 
[ PubMed ID = 25190516 ] [ RRC reference ]

Staab TA, Evgrafov O, Knowles JA, Sieburth D.
Regulation of synaptic nlg-1/neuroligin abundance by the skn-1/Nrf stress response pathway protects against oxidative stress.
PLoS Genet. 2014 10(1) e1004100 
[ PubMed ID = 24453991 ] [ RRC reference ]

Staab TA, Griffen TC, Corcoran C, Evgrafov O, Knowles JA, Sieburth D.
The conserved SKN-1/Nrf2 stress response pathway regulates synaptic function in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003354 
[ PubMed ID = 23555279 ] [ RRC reference ]

Breckenridge DG, Kang BH, Xue D.
Bcl-2 proteins EGL-1 and CED-9 do not regulate mitochondrial fission or fusion in Caenorhabditis elegans.
Curr. Biol. 2009 19(9) 768-73 
[ PubMed ID = 19327994 ] [ RRC reference ]

Rolland SG, Lu Y, David CN, Conradt B.
The BCL-2-like protein CED-9 of C. elegans promotes FZO-1/Mfn1,2- and EAT-3/Opa1-dependent mitochondrial fusion.
J. Cell Biol. 2009 186(4) 525-40 
[ PubMed ID = 19704021 ] [ RRC reference ]

Jiang HC, Hsu JM, Yen CP, Chao CC, Chen RH, Pan CL.
Neural activity and CaMKII protect mitochondria from fragmentation in aging Caenorhabditis elegans neurons.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(28) 8768-73 
[ PubMed ID = 26124107 ] [ RRC reference ]

Kim H, Perentis RJ, Caldwell GA, Caldwell KA.
Gene-by-environment interactions that disrupt mitochondrial homeostasis cause neurodegeneration in C. elegans Parkinson's models.
Cell Death Dis 2018 9(5) 555 
[ PubMed ID = 29748634 ] [ RRC reference ]

Wang Y, Zhang Y, Chen L, Liang Q, Yin XM, Miao L, Kang BH, Xue D.
Kinetics and specificity of paternal mitochondrial elimination in Caenorhabditis elegans.
Nat Commun 2016 7 12569 
[ PubMed ID = 27581092 ] [ RRC reference ]

Johnson D, Nehrke K.
Mitochondrial fragmentation leads to intracellular acidification in Caenorhabditis elegans and mammalian cells.
Mol. Biol. Cell 2010 21(13) 2191-201 
[ PubMed ID = 20444981 ] [ RRC reference ]

Luz AL, Godebo TR, Smith LL, Leuthner TC, Maurer LL, Meyer JN.
Deficiencies in mitochondrial dynamics sensitize Caenorhabditis elegans to arsenite and other mitochondrial toxicants by reducing mitochondrial adaptability.
Toxicology 2017 387 81-94 
[ PubMed ID = 28602540 ] [ RRC reference ]

Weir HJ, Yao P, Huynh FK, Escoubas CC, Goncalves RL, Burkewitz K, Laboy R, Hirschey MD, Mair WB.
Dietary Restriction and AMPK Increase Lifespan via Mitochondrial Network and Peroxisome Remodeling.
Cell Metab. 2017 26(6) 884-896.e5 
[ PubMed ID = 29107506 ] [ RRC reference ]

Luz AL, Rooney JP, Kubik LL, Gonzalez CP, Song DH, Meyer JN.
Mitochondrial Morphology and Fundamental Parameters of the Mitochondrial Respiratory Chain Are Altered in Caenorhabditis elegans Strains Deficient in Mitochondrial Dynamics and Homeostasis Processes.
PLoS ONE 2015 10(6) e0130940 
[ PubMed ID = 26106885 ] [ RRC reference ]