Mutants (Isolated)

tm1108

Allele Name

tm1108

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T12E12.4

Gene Name

drp-1

Worm Base

Allele Name

tm1108

Gene Name

drp-1

Sequence

T12E12.4

Phenotype

homozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.

Mutation site

1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)

Chromosome

Putative gene structure

join(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)

Map position

1.82

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Munden AL, Lui DS, Higgins DP, Fanelli MJ, Ngyuen TK, Edwards KM, Ericsson M, Godbole AA, Haley JA, Lewis C, Spinelli JB, Harrison B, Raftery D, Djukovic D, Promislow DEL, Miller DL, Walker AK.
Functional Specialization of S-Adenosylmethionine Synthases Links Phosphatidylcholine to Mitochondrial Function and Stress Survival.
bioRxiv 2025
[ PubMed ID = 40027629 ] [ RRC reference ]

Traa A, Tamez González AA, Van Raamsdonk JM.
Developmental disruption of the mitochondrial fission gene drp-1 extends the longevity of daf-2 insulin/IGF-1 receptor mutant.
Geroscience 2025 47(1) 877-902
[ PubMed ID = 39028454 ] [ RRC reference ]

Wang S, Xue D.
Asymmetric partitioning of persistent paternal mitochondria during cell divisions safeguards embryo development and mitochondrial inheritance.
Dev Cell 2025
[ PubMed ID = 39904343 ] [ RRC reference ]

Wu Z, Cardona EA, Cohn JA, Pierce JT.
Nonapoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2025 122(2) e2407909122
[ PubMed ID = 39786930 ] [ RRC reference ]

Matsunaga Y, Qadota H, Ghazal N, Lesanpezeshki L, Dorendorf T, Moody JC, Ahier A, Matheny CJ, Vanapalli SA, Zuryn S, Mayans O, Kwong JQ, Benian GM.
Protein kinase 2 of the giant sarcomeric protein UNC-89 regulates mitochondrial morphology and function.
Commun Biol 2024 7(1) 1342
[ PubMed ID = 39420071 ] [ RRC reference ]

Chen L, Chen G, Gai T, Zhou X, Zhu J, Wang R, Wang X, Guo Y, Wang Y, Xie Z.
L-Theanine Prolongs the Lifespan by Activating Multiple Molecular Pathways in Ultraviolet C-Exposed Caenorhabditis elegans.
Molecules 2024 29(11)
[ PubMed ID = 38893565 ] [ RRC reference ]

Wu Z, Cardona EA, Pierce JT.
Non-apoptotic role of EGL-1 in exopher production and neuronal health in Caenorhabditis elegans.
bioRxiv 2024
[ PubMed ID = 38712027 ] [ RRC reference ]

Chen TY, Wang FY, Lee PJ, Hsu AL, Ching TT.
Mitochondrial S-adenosylmethionine deficiency induces mitochondrial unfolded protein response and extends lifespan in Caenorhabditis elegans.
Aging Cell 2024 23(4) e14103
[ PubMed ID = 38361361 ] [ RRC reference ]

Cooper JF, Nguyen K, Gates D, Wolfrum E, Capan C, Lee H, Williams D, Okoye C, Wojtovich AP, Burton NO.
Oocyte mitochondria link maternal environment to offspring phenotype.
Res Sq 2024
[ PubMed ID = 38585755 ] [ RRC reference ]

Campbell D, Zuryn S.
The mechanisms and roles of mitochondrial dynamics in C. elegans.
Semin Cell Dev Biol 2024 156 266-275
[ PubMed ID = 37919144 ] [ RRC reference ]

Michaeli L, Spector E, Haeussler S, Carvalho CA, Grobe H, Abu-Shach UB, Zinger H, Conradt B, Broday L.
ULP-2 SUMO protease regulates UPR^mt and mitochondrial homeostasis in Caenorhabditis elegans.
Free Radic Biol Med 2024 214 19-27
[ PubMed ID = 38301974 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702
[ PubMed ID = 38402241 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024
[ PubMed ID = 38405845 ] [ RRC reference ]

Zhang R, Fang J, Qi T, Zhu S, Yao L, Fang G, Li Y, Zang X, Xu W, Hao W, Liu S, Yang D, Chen D, Yang J, Ma X, Wu L.
Maternal aging increases offspring adult body size via transmission of donut-shaped mitochondria.
Cell Res 2023 33(11) 821-834
[ PubMed ID = 37500768 ] [ RRC reference ]

Fang J, Wang J, Wang Y, Liu X, Chen B, Zou W.
Ribo-On and Ribo-Off tools using a self-cleaving ribozyme allow manipulation of endogenous gene expression in C. elegans.
Commun Biol 2023 6(1) 816
[ PubMed ID = 37542105 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120
[ PubMed ID = 36595699 ] [ RRC reference ]

Aman Y, Erinjeri AP, Tataridas-Pallas N, Williams R, Wellman R, Chapman H, Labbadia J.
Loss of MTCH-1 suppresses age-related proteostasis collapse through the inhibition of programmed cell death factors.
Cell Rep 2022 41(8) 111690
[ PubMed ID = 36417880 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400
[ PubMed ID = 36126046 ] [ RRC reference ]

Guha S, Cheng A, Carroll T, King D, Koren SA, Swords S, Nehrke K, Johnson GVW.
Selective disruption of Drp1-independent mitophagy and mitolysosome trafficking by an Alzheimer's disease relevant tau modification in a novel Caenorhabditis elegans model.
Genetics 2022 222(1)
[ PubMed ID = 35916724 ] [ RRC reference ]

Ma T, Zhao L, Zhang J, Tang R, Wang X, Liu N, Zhang Q, Wang F, Li M, Shan Q, Yang Y, Yin Q, Yang L, Gan Q, Yang C.
A pair of transporters controls mitochondrial Zn²⁺ levels to maintain mitochondrial homeostasis.
Protein Cell 2022 13(3) 180-202
[ PubMed ID = 34687432 ] [ RRC reference ]