分離済み変異体

tm1108

Allele Name

tm1108

Allele Type

通常株

Sequence Name

T12E12.4

Gene Name

drp-1

Worm Base

Allele Name

tm1108

Gene Name

drp-1

Sequence

T12E12.4

Phenotype

homozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.

Mutation site

1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)

Chromosome

Putative gene structure

join(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)

Map position

1.82

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Michaeli L, Spector E, Haeussler S, Carvalho CA, Grobe H, Abu-Shach UB, Zinger H, Conradt B, Broday L.
ULP-2 SUMO protease regulates UPR^mt and mitochondrial homeostasis in Caenorhabditis elegans.
Free Radic Biol Med 2024 214 19-27
[ PubMed ID = 38301974 ] [ RRC reference ]

Campbell D, Zuryn S.
The mechanisms and roles of mitochondrial dynamics in C. elegans.
Semin Cell Dev Biol 2024 156 266-275
[ PubMed ID = 37919144 ] [ RRC reference ]

Fang J, Wang J, Wang Y, Liu X, Chen B, Zou W.
Ribo-On and Ribo-Off tools using a self-cleaving ribozyme allow manipulation of endogenous gene expression in C. elegans.
Commun Biol 2023 6(1) 816
[ PubMed ID = 37542105 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702
[ PubMed ID = 38402241 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024
[ PubMed ID = 38405845 ] [ RRC reference ]

Chen TY, Wang FY, Lee PJ, Hsu AL, Ching TT.
Mitochondrial S-adenosylmethionine deficiency induces mitochondrial unfolded protein response and extends lifespan in Caenorhabditis elegans.
Aging Cell 2024 23(4) e14103
[ PubMed ID = 38361361 ] [ RRC reference ]

Zhang R, Fang J, Qi T, Zhu S, Yao L, Fang G, Li Y, Zang X, Xu W, Hao W, Liu S, Yang D, Chen D, Yang J, Ma X, Wu L.
Maternal aging increases offspring adult body size via transmission of donut-shaped mitochondria.
Cell Res 2023 33(11) 821-834
[ PubMed ID = 37500768 ] [ RRC reference ]

Vozdek R, Wang B, Li KH, Pramstaller PP, Hicks AA, Ma DK.
Fluorescent reporter of Caenorhabditis elegans Parkin: Regulators of its abundance and role in autophagy-lysosomal dynamics.
Open Res Eur 2022 2 23
[ PubMed ID = 37811477 ] [ RRC reference ]

Guha S, Cheng A, Carroll T, King D, Koren SA, Swords S, Nehrke K, Johnson GVW.
Selective disruption of Drp1-independent mitophagy and mitolysosome trafficking by an Alzheimer's disease relevant tau modification in a novel Caenorhabditis elegans model.
Genetics 2022 222(1)
[ PubMed ID = 35916724 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400
[ PubMed ID = 36126046 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120
[ PubMed ID = 36595699 ] [ RRC reference ]

Aman Y, Erinjeri AP, Tataridas-Pallas N, Williams R, Wellman R, Chapman H, Labbadia J.
Loss of MTCH-1 suppresses age-related proteostasis collapse through the inhibition of programmed cell death factors.
Cell Rep 2022 41(8) 111690
[ PubMed ID = 36417880 ] [ RRC reference ]

Traa A, Machiela E, Rudich PD, Soo SK, Senchuk MM, Van Raamsdonk JM.
Identification of Novel Therapeutic Targets for Polyglutamine Diseases That Target Mitochondrial Fragmentation.
Int J Mol Sci 2021 22(24)
[ PubMed ID = 34948242 ] [ RRC reference ]

Ma T, Zhao L, Zhang J, Tang R, Wang X, Liu N, Zhang Q, Wang F, Li M, Shan Q, Yang Y, Yin Q, Yang L, Gan Q, Yang C.
A pair of transporters controls mitochondrial Zn²⁺ levels to maintain mitochondrial homeostasis.
Protein Cell 2022 13(3) 180-202
[ PubMed ID = 34687432 ] [ RRC reference ]

Gitschlag BL, Tate AT, Patel MR.
Nutrient status shapes selfish mitochondrial genome dynamics across different levels of selection.
Elife 2020 9
[ PubMed ID = 32959778 ] [ RRC reference ]

Zheng F, Chen P, Li H, Aschner M.
Drp-1-Dependent Mitochondrial Fragmentation Contributes to Cobalt Chloride-Induced Toxicity in Caenorhabditis elegans.
Toxicol Sci 2020 177(1) 158-167
[ PubMed ID = 32617571 ] [ RRC reference ]

Liu YJ, McIntyre RL, Janssens GE, Williams EG, Lan J, van Weeghel M, Schomakers B, van der Veen H, van der Wel NN, Yao P, Mair WB, Aebersold R, MacInnes AW, Houtkooper RH.
Mitochondrial translation and dynamics synergistically extend lifespan in C. elegans through HLH-30.
J Cell Biol 2020 219(6)
[ PubMed ID = 32259199 ] [ RRC reference ]

Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216
[ PubMed ID = 32294300 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492
[ PubMed ID = 32385951 ] [ RRC reference ]

Shin MG, Lee JW, Han JS, Lee B, Jeong JH, Park SH, Kim JH, Jang S, Park M, Kim SY, Kim S, Yang YR, Kim JY, Hoe KL, Park C, Lee KP, Kwon KS, Kwon ES.
Bacteria-derived metabolite, methylglyoxal, modulates the longevity of C. elegans through TORC2/SGK-1/DAF-16 signaling.
Proc Natl Acad Sci U S A 2020 117(29) 17142-17150
[ PubMed ID = 32636256 ] [ RRC reference ]