Mutants (Isolated)

tm1108

Allele Nametm1108
Sequence NameT12E12.4
CGC Namedrp-1
Worm BaseAllele Name tm1108
CGC Name drp-1
Sequence T12E12.4
Phenotypehomozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.
Mutation site1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)
ChromosomeIV
Putative gene structurejoin(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)
Map position1.82
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gitschlag BL, Tate AT, Patel MR.
Nutrient status shapes selfish mitochondrial genome dynamics across different levels of selection.
Elife 2020 9  
[ PubMed ID = 32959778 ] [ RRC reference ]

Zheng F, Chen P, Li H, Aschner M.
Drp-1-Dependent Mitochondrial Fragmentation Contributes to Cobalt Chloride-Induced Toxicity in Caenorhabditis elegans.
Toxicol Sci 2020 177(1) 158-167 
[ PubMed ID = 32617571 ] [ RRC reference ]

Shin MG, Lee JW, Han JS, Lee B, Jeong JH, Park SH, Kim JH, Jang S, Park M, Kim SY, Kim S, Yang YR, Kim JY, Hoe KL, Park C, Lee KP, Kwon KS, Kwon ES.
Bacteria-derived metabolite, methylglyoxal, modulates the longevity of C. elegans through TORC2/SGK-1/DAF-16 signaling.
Proc Natl Acad Sci U S A 2020 117(29) 17142-17150 
[ PubMed ID = 32636256 ] [ RRC reference ]

Wei W, Ruvkun G.
Lysosomal activity regulates Caenorhabditis elegans mitochondrial dynamics through vitamin B12 metabolism.
Proc Natl Acad Sci U S A 2020 117(33) 19970-19981 
[ PubMed ID = 32737159 ] [ RRC reference ]

Lan J, Rollins JA, Zang X, Wu D, Zou L, Wang Z, Ye C, Wu Z, Kapahi P, Rogers AN, Chen D.
Translational Regulation of Non-autonomous Mitochondrial Stress Response Promotes Longevity.
Cell Rep 2019 28(4) 1050-1062.e6 
[ PubMed ID = 31340143 ] [ RRC reference ]

Caldwell KA, Thies JL, Caldwell GA.
No Country for Old Worms: A Systematic Review of the Application of C. elegans to Investigate a Bacterial Source of Environmental Neurotoxicity in Parkinson's Disease.
Metabolites 2018 8(4)  
[ PubMed ID = 30380609 ] [ RRC reference ]

Scholtes C, Bellemin S, Martin E, Carre-Pierrat M, Mollereau B, Gieseler K, Walter L.
DRP-1-mediated apoptosis induces muscle degeneration in dystrophin mutants.
Sci Rep 2018 8(1) 7354 
[ PubMed ID = 29743663 ] [ RRC reference ]

Byrne JJ, Soh MS, Chandhok G, Vijayaraghavan T, Teoh JS, Crawford S, Cobham AE, Yapa NMB, Mirth CK, Neumann B.
Disruption of mitochondrial dynamics affects behaviour and lifespan in Caenorhabditis elegans.
Cell Mol Life Sci 2019 76(10) 1967-1985 
[ PubMed ID = 30840087 ] [ RRC reference ]

Zhang Y, Lanjuin A, Chowdhury SR, Mistry M, Silva-García CG, Weir HJ, Lee CL, Escoubas CC, Tabakovic E, Mair WB.
Neuronal TORC1 modulates longevity via AMPK and cell nonautonomous regulation of mitochondrial dynamics in C. elegans.
Elife 2019 8  
[ PubMed ID = 31411562 ] [ RRC reference ]

Yen CA, Ruter DL, Turner CD, Pang S, Curran SP.
Loss of flavin adenine dinucleotide (FAD) impairs sperm function and male reproductive advantage in C. elegans.
Elife 2020 9  
[ PubMed ID = 32022684 ] [ RRC reference ]

Pryor R, Norvaisas P, Marinos G, Best L, Thingholm LB, Quintaneiro LM, De Haes W, Esser D, Waschina S, Lujan C, Smith RL, Scott TA, Martinez-Martinez D, Woodward O, Bryson K, Laudes M, Lieb W, Houtkooper RH, Franke A, Temmerman L, Bjedov I, Cochemé HM, Kaleta C, Cabreiro F.
Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy.
Cell 2019 178(6) 1299-1312.e29 
[ PubMed ID = 31474368 ] [ RRC reference ]

Charmpilas N, Tavernarakis N.
Mitochondrial maturation drives germline stem cell differentiation in Caenorhabditis elegans.
Cell Death Differ 2020 27(2) 601-617 
[ PubMed ID = 31217501 ] [ RRC reference ]

Zhou J, Wang X, Wang M, Chang Y, Zhang F, Ban Z, Tang R, Gan Q, Wu S, Guo Y, Zhang Q, Wang F, Zhao L, Jing Y, Qian W, Wang G, Guo W, Yang C.
The lysine catabolite saccharopine impairs development by disrupting mitochondrial homeostasis.
J Cell Biol 2019 218(2) 580-597 
[ PubMed ID = 30573525 ] [ RRC reference ]

Liu YJ, McIntyre RL, Janssens GE, Williams EG, Lan J, van Weeghel M, Schomakers B, van der Veen H, van der Wel NN, Yao P, Mair WB, Aebersold R, MacInnes AW, Houtkooper RH.
Mitochondrial translation and dynamics synergistically extend lifespan in C. elegans through HLH-30.
J Cell Biol 2020 219(6)  
[ PubMed ID = 32259199 ] [ RRC reference ]

Zhao YG, Chen Y, Miao G, Zhao H, Qu W, Li D, Wang Z, Liu N, Li L, Chen S, Liu P, Feng D, Zhang H.
The ER-Localized Transmembrane Protein EPG-3/VMP1 Regulates SERCA Activity to Control ER-Isolation Membrane Contacts for Autophagosome Formation.
Mol Cell 2017 67(6) 974-989.e6 
[ PubMed ID = 28890335 ] [ RRC reference ]

Hibshman JD, Leuthner TC, Shoben C, Mello DF, Sherwood DR, Meyer JN, Baugh LR.
Nonselective autophagy reduces mitochondrial content during starvation in Caenorhabditis elegans.
Am J Physiol Cell Physiol 2018 315(6) C781-C792 
[ PubMed ID = 30133321 ] [ RRC reference ]

Wang Y, Zhang Y, Chen L, Liang Q, Yin XM, Miao L, Kang BH, Xue D.
Kinetics and specificity of paternal mitochondrial elimination in Caenorhabditis elegans.
Nat Commun 2016 7 12569 
[ PubMed ID = 27581092 ] [ RRC reference ]

Earls LR, Hacker ML, Watson JD, Miller DM 3rd.
Coenzyme Q protects Caenorhabditis elegans GABA neurons from calcium-dependent degeneration.
Proc Natl Acad Sci U S A 2010 107(32) 14460-5 
[ PubMed ID = 20663955 ] [ RRC reference ]

Yang CC, Chen D, Lee SS, Walter L.
The dynamin-related protein DRP-1 and the insulin signaling pathway cooperate to modulate Caenorhabditis elegans longevity.
Aging Cell 2011 10(4) 724-8 
[ PubMed ID = 21463460 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]