Mutants (Isolated)

tm1108

Allele Nametm1108
Sequence NameT12E12.4
CGC Namedrp-1
Worm BaseAllele Name tm1108
CGC Name drp-1
Sequence T12E12.4
Phenotypehomozygous viable. Dr. H-S. Koo: embryonic lethality of 15%, L1-L3 larval arrest of lethality of 60%. Dr. A. van der Bliek: Sma, Gro. normal locomotion. connected mitochondria in muscle and hypodermal cells. Dr. D. Xue: slow growth but not lethal or sterile. Mol Cell, 31, 586 (2008). Dr. J. Kaplan: resistant to aldicarb.
Mutation site1053/1054-CTCCAGCGAACCAGGATT-1477/1478 (425 bp deletion + 18 bp insertion)
ChromosomeIV
Putative gene structurejoin(429..741, 792..1357, 1403..2152, 2269..2419, 2470..2559, 2612..2706, 2758..2874, 2924..2956, 3004..3012)
Map position1.82
Balancer
Map position of balancer
Sequence of primersExtFwd:TGAGTAAGTGGCAGGATCGA,IntFwd:CGAAGGCCAAGTAGACTATC,ExtRev:GAGGTTAAGCCCATGCAATA,IntRev:CCCAGTCAGTCATCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lan J, Rollins JA, Zang X, Wu D, Zou L, Wang Z, Ye C, Wu Z, Kapahi P, Rogers AN, Chen D.
Translational Regulation of Non-autonomous Mitochondrial Stress Response Promotes Longevity.
Cell Rep 2019 28(4) 1050-1062.e6 
[ PubMed ID = 31340143 ] [ RRC reference ]

Scholtes C, Bellemin S, Martin E, Carre-Pierrat M, Mollereau B, Gieseler K, Walter L.
DRP-1-mediated apoptosis induces muscle degeneration in dystrophin mutants.
Sci Rep 2018 8(1) 7354 
[ PubMed ID = 29743663 ] [ RRC reference ]

Zhang Y, Lanjuin A, Chowdhury SR, Mistry M, Silva-García CG, Weir HJ, Lee CL, Escoubas CC, Tabakovic E, Mair WB.
Neuronal TORC1 modulates longevity via AMPK and cell nonautonomous regulation of mitochondrial dynamics in C. elegans.
Elife 2019 8  
[ PubMed ID = 31411562 ] [ RRC reference ]

Yen CA, Ruter DL, Turner CD, Pang S, Curran SP.
Loss of flavin adenine dinucleotide (FAD) impairs sperm function and male reproductive advantage in C. elegans.
Elife 2020 9  
[ PubMed ID = 32022684 ] [ RRC reference ]

Pryor R, Norvaisas P, Marinos G, Best L, Thingholm LB, Quintaneiro LM, De Haes W, Esser D, Waschina S, Lujan C, Smith RL, Scott TA, Martinez-Martinez D, Woodward O, Bryson K, Laudes M, Lieb W, Houtkooper RH, Franke A, Temmerman L, Bjedov I, Cochemé HM, Kaleta C, Cabreiro F.
Host-Microbe-Drug-Nutrient Screen Identifies Bacterial Effectors of Metformin Therapy.
Cell 2019 178(6) 1299-1312.e29 
[ PubMed ID = 31474368 ] [ RRC reference ]

Charmpilas N, Tavernarakis N.
Mitochondrial maturation drives germline stem cell differentiation in Caenorhabditis elegans.
Cell Death Differ. 2020 27(2) 601-617 
[ PubMed ID = 31217501 ] [ RRC reference ]

Zhou J, Wang X, Wang M, Chang Y, Zhang F, Ban Z, Tang R, Gan Q, Wu S, Guo Y, Zhang Q, Wang F, Zhao L, Jing Y, Qian W, Wang G, Guo W, Yang C.
The lysine catabolite saccharopine impairs development by disrupting mitochondrial homeostasis.
J. Cell Biol. 2019 218(2) 580-597 
[ PubMed ID = 30573525 ] [ RRC reference ]

Byrne JJ, Soh MS, Chandhok G, Vijayaraghavan T, Teoh JS, Crawford S, Cobham AE, Yapa NMB, Mirth CK, Neumann B.
Disruption of mitochondrial dynamics affects behaviour and lifespan in Caenorhabditis elegans.
Cell. Mol. Life Sci. 2019 76(10) 1967-1985 
[ PubMed ID = 30840087 ] [ RRC reference ]

Zhao YG, Chen Y, Miao G, Zhao H, Qu W, Li D, Wang Z, Liu N, Li L, Chen S, Liu P, Feng D, Zhang H.
The ER-Localized Transmembrane Protein EPG-3/VMP1 Regulates SERCA Activity to Control ER-Isolation Membrane Contacts for Autophagosome Formation.
Mol. Cell 2017 67(6) 974-989.e6 
[ PubMed ID = 28890335 ] [ RRC reference ]

Wang Y, Zhang Y, Chen L, Liang Q, Yin XM, Miao L, Kang BH, Xue D.
Kinetics and specificity of paternal mitochondrial elimination in Caenorhabditis elegans.
Nat Commun 2016 7 12569 
[ PubMed ID = 27581092 ] [ RRC reference ]

Haeussler S, Köhler F, Witting M, Premm MF, Rolland SG, Fischer C, Chauve L, Casanueva O, Conradt B.
Autophagy compensates for defects in mitochondrial dynamics.
PLoS Genet. 2020 16(3) e1008638 
[ PubMed ID = 32191694 ] [ RRC reference ]

Govindan JA, Jayamani E, Ruvkun G.
ROS-based lethality of Caenorhabditis elegans mitochondrial electron transport mutants grown on Escherichia coli siderophore iron release mutants.
Proc. Natl. Acad. Sci. U.S.A. 2019 116(43) 21651-21658 
[ PubMed ID = 31591219 ] [ RRC reference ]

Earls LR, Hacker ML, Watson JD, Miller DM 3rd.
Coenzyme Q protects Caenorhabditis elegans GABA neurons from calcium-dependent degeneration.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(32) 14460-5 
[ PubMed ID = 20663955 ] [ RRC reference ]

Yang CC, Chen D, Lee SS, Walter L.
The dynamin-related protein DRP-1 and the insulin signaling pathway cooperate to modulate Caenorhabditis elegans longevity.
Aging Cell 2011 10(4) 724-8 
[ PubMed ID = 21463460 ] [ RRC reference ]

Lu Y, Rolland SG, Conradt B.
A molecular switch that governs mitochondrial fusion and fission mediated by the BCL2-like protein CED-9 of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(41) E813-22 
[ PubMed ID = 21949250 ] [ RRC reference ]

Regmi SG, Rolland SG, Conradt B.
Age-dependent changes in mitochondrial morphology and volume are not predictors of lifespan.
Aging (Albany NY) 2014 6(2) 118-30 
[ PubMed ID = 24642473 ] [ RRC reference ]

Abdelwahid E, Rolland S, Teng X, Conradt B, Hardwick JM, White K.
Mitochondrial involvement in cell death of non-mammalian eukaryotes.
Biochim. Biophys. Acta 2011 1813(4) 597-607 
[ PubMed ID = 20950655 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050 
[ PubMed ID = 32103012 ] [ RRC reference ]

Staab TA, Griffen TC, Corcoran C, Evgrafov O, Knowles JA, Sieburth D.
The conserved SKN-1/Nrf2 stress response pathway regulates synaptic function in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003354 
[ PubMed ID = 23555279 ] [ RRC reference ]