Home > Mutants (Isolated) > tm11071

Mutants (Isolated)

tm11071

Allele Nametm11071
BalanceCompleted
OutCrossCompleted
Sequence NameY71A12C.1 Y71A12C.4 Y71A12C.3 Y71A12C.2 F47G4.7 F47G4.8 F47G4.1 F47G4.9 F47G4.6 F47G4.5 F47G4.4
Gene NameY71A12C.1 Y71A12C.4 Y71A12C.3 Y71A12C.2 F47G4.7 F47G4.8 F47G4.1 F47G4.9 F47G4.6 F47G4.5 F47G4.4
Worm BaseAllele Name tm11071 (x1)
Gene Name Y71A12C.1 Y71A12C.4 Y71A12C.3 Y71A12C.2 F47G4.7 F47G4.8 F47G4.1 F47G4.9 F47G4.6 F47G4.5 F47G4.4
Sequence Y71A12C.1 Y71A12C.4 Y71A12C.3 Y71A12C.2 F47G4.7 F47G4.8 F47G4.1 F47G4.9 F47G4.6 F47G4.5 F47G4.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y71A12C]1616/1617-[F47G4]22385/22386 (28105 bp deletion)
ChromosomeI
Putative gene structureY71A12C.1 = join(258..314, 783..1488, 1850..2061, 2328..2465); Y71A12C.2 = complement(join(4872..5083, 5375..5513, 5783..5944, 5999..6137, 6442..6515, 6562..6648)); F47G4.7 = complement(join(AL023853.1:7169..7264, 472..601, 649..866, 916..1578)); F47G4.8 = complement(join(3415..3506, 3557..3702, 4088..4228, 5222..5349, 5390..5449)); F47G4.1 = complement(join(5888..5954, 6083..6228, 6462..6601, 6845..6956, 7300..7443, 7485..7622, 8076..8189)); F47G4.6 = join(10715..10866, 11426..11561, 12014..12112); F47G4.5 = complement(join(12171..12275, 12325..12497, 12545..12688, 12931..13220, 13277..13407)); F47G4.4 = complement(join(14184..14288, 14340..14512, 14561..14725, 14773..15104, 15162..15460, 15776..15913, 15961..16140, 16554..16654, 16707..16854, 16909..17049, 17584..17841, 18855..18970, 20048..20060))
Map position
BalancerhIn1[nIs425]
Map position of balancer
Sequence of primersExtFwd:ATAAACCCCGAGGACCAGGG,ExtRev:ACCAAGTAAGACCTAGCTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication