分離済み変異体

tm11064

Allele Nametm11064
BalanceNot Required
OutCrossRequest Available
Sequence NameY39D8B.3 ZK6.8 ZK6.7 ZK6.6 ZK6.5 ZK6.4 ZK6.3
Gene NameY39D8B.3 ZK6.8 ZK6.7 ZK6.6 ZK6.5 ZK6.4 ZK6.3
Worm BaseAllele Name tm11064
Gene Name Y39D8B.3 ZK6.8 ZK6.7 ZK6.6 ZK6.5 ZK6.4 ZK6.3
Sequence Y39D8B.3 ZK6.8 ZK6.7 ZK6.6 ZK6.5 ZK6.4 ZK6.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y39D8B]17773/17774-[ZK6]21605/21606 (23935 bp deletion)
ChromosomeV
Putative gene structureY39D8B.3 = complement(join(14696..15250, 15535..15735, 16137..16475, 17187..17311, 17828..17954, 18005..18155, 18905..19199, 19253..19416, 19674..19873, 19922..19960)); ZK6.8 = join(2105..2307, 3036..3223, 3287..3515, 3586..3905, 3956..4127, 4306..4441, 4490..4708); ZK6.7 = join(5937..6023, 6070..6169, 6669..7138, 7228..7527, 7576..7713, 7765..7881); ZK6.6 = join(9944..10074, 10127..10257, 10841..11029, 11081..11252, 11314..11449, 11501..11716); ZK6.5 = join(12832..12894, 13721..13817, 13864..14452, 14605..14686, 14731..14865); ZK6.4 = join(17012..17074, 17511..17607, 17658..18272, 18679..18941); ZK6.3 = join(20442..20615, 20667..20801, 21444..21631, 21682..21787)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:TACGCGGGAACAGTATGACC,ExtFwd:CGCGTCTTTTGTCTTACCCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication