Home > Mutants (Isolated) > tm11040

Mutants (Isolated)

tm11040

Allele Nametm11040
BalanceNot Required
OutCrossRequest Available
Sequence NameY10G11A.1 Y10G11A.91 Y10G11A.2 Y10G11A.92 Y10G11A.3 VY10G11R.4 VY10G11R.3 VY10G11R.2 VY10G11R.1
Gene NameY10G11A.1 Y10G11A.91 Y10G11A.2 Y10G11A.92 Y10G11A.3 VY10G11R.4 VY10G11R.3 VY10G11R.2 VY10G11R.1
Worm BaseAllele Name tm11040
Gene Name Y10G11A.1 Y10G11A.91 Y10G11A.2 Y10G11A.92 Y10G11A.3 VY10G11R.4 VY10G11R.3 VY10G11R.2 VY10G11R.1
Sequence Y10G11A.1 Y10G11A.91 Y10G11A.2 Y10G11A.92 Y10G11A.3 VY10G11R.4 VY10G11R.3 VY10G11R.2 VY10G11R.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y10G11A]1844/1845-[Y51H4A]1109/1110 (53791 bp deletion)
ChromosomeIV
Putative gene structureY10G11A.1 = join(7341..7669, 8356..8445, 10023..10392, 12179..12295); Y10G11A.91 = 11420..11545; Y10G11A.2 = join(14942..14979, 19012..19202, 20474..20580); Y10G11A.92 = complement(23189..23244); Y10G11A.3 = join(27391..27482, 28656..28846, 29268..29374); VY10G11R.4 = complement(3383..3692); VY10G11R.3 = complement(11736..11941); VY10G11R.2 = complement(join(17836..18056, 18102..18177)); VY10G11R.1 = complement(join(18693..18785, 18829..19593, 19899..19994))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:CGTGATCCTACTCTCTAATG,ExtFwd:CCCAAGACAGTATCCCTTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication