Mutants (Isolated)

tm1099

Allele Nametm1099
Sequence NameF41D9.3
CGC Namewrk-1
Worm BaseAllele Name tm1099
CGC Name wrk-1
Sequence F41D9.3
Phenotypehomozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. Dr. O. Hobert: Current Biology in press.
Mutation site12895/12896-13989/13990 (1094 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(10567..10646, 11221..11538, 11996..12161, 12215..12345, 13202..13225, 13553..13703, 13809..13936, 14721..14826, 14909..15055, 15101..15184))
Map position-0.14
Balancer
Map position of balancer
Sequence of primersIntFwd:ACAGAGCCGATTCATCCTAA,ExtFwd:CGTTCTTACCCCACCGACCT,IntRev:GATGGAAGGCTCGGTAACTA,ExtRev:CTCACCTTGAGATGCGAAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A.
Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(35) 8823-8828 
[ PubMed ID = 30104389 ] [ RRC reference ]

Murata D, Nomura KH, Dejima K, Mizuguchi S, Kawasaki N, Matsuishi-Nakajima Y, Ito S, Gengyo-Ando K, Kage-Nakadai E, Mitani S, Nomura K.
GPI-anchor synthesis is indispensable for the germline development of the nematode Caenorhabditis elegans.
Mol. Biol. Cell 2012 23(6) 982-95 
[ PubMed ID = 22298425 ] [ RRC reference ]

Lakhina V, Arey RN, Kaletsky R, Kauffman A, Stein G, Keyes W, Xu D, Murphy CT.
Genome-wide functional analysis of CREB/long-term memory-dependent transcription reveals distinct basal and memory gene expression programs.
Neuron 2015 85(2) 330-45 
[ PubMed ID = 25611510 ] [ RRC reference ]

Faumont S, Boulin T, Hobert O, Lockery SR.
Developmental regulation of whole cell capacitance and membrane current in identified interneurons in C. elegans.
J. Neurophysiol. 2006 95(6) 3665-73 
[ PubMed ID = 16554520 ] [ RRC reference ]

Boulin T, Pocock R, Hobert O.
A novel Eph receptor-interacting IgSF protein provides C. elegans motoneurons with midline guidepost function.
Curr. Biol. 2006 16(19) 1871-83 
[ PubMed ID = 17027485 ] [ RRC reference ]