Mutants (Isolated)

tm1099

Allele Name

tm1099

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F41D9.3

Gene Name

wrk-1

Worm Base

Allele Name

tm1099

Gene Name

wrk-1

Sequence

F41D9.3

Phenotype

homozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. Dr. O. Hobert: Current Biology in press.

Mutation site

12895/12896-13989/13990 (1094 bp deletion)

Chromosome

Putative gene structure

complement(join(10567..10646, 11221..11538, 11996..12161, 12215..12345, 13202..13225, 13553..13703, 13809..13936, 14721..14826, 14909..15055, 15101..15184))

Map position

-0.14

Balancer

Map position of balancer

Sequence of primers

IntFwd:ACAGAGCCGATTCATCCTAA,ExtFwd:CGTTCTTACCCCACCGACCT,IntRev:GATGGAAGGCTCGGTAACTA,ExtRev:CTCACCTTGAGATGCGAAGT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A.
Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2018 115(35) 8823-8828
[ PubMed ID = 30104389 ] [ RRC reference ]

Lakhina V, Arey RN, Kaletsky R, Kauffman A, Stein G, Keyes W, Xu D, Murphy CT.
Genome-wide functional analysis of CREB/long-term memory-dependent transcription reveals distinct basal and memory gene expression programs.
Neuron 2015 85(2) 330-45
[ PubMed ID = 25611510 ] [ RRC reference ]

Murata D, Nomura KH, Dejima K, Mizuguchi S, Kawasaki N, Matsuishi-Nakajima Y, Ito S, Gengyo-Ando K, Kage-Nakadai E, Mitani S, Nomura K.
GPI-anchor synthesis is indispensable for the germline development of the nematode Caenorhabditis elegans.
Mol Biol Cell 2012 23(6) 982-95
[ PubMed ID = 22298425 ] [ RRC reference ]

Boulin T, Pocock R, Hobert O.
A novel Eph receptor-interacting IgSF protein provides C. elegans motoneurons with midline guidepost function.
Curr Biol 2006 16(19) 1871-83
[ PubMed ID = 17027485 ] [ RRC reference ]

Faumont S, Boulin T, Hobert O, Lockery SR.
Developmental regulation of whole cell capacitance and membrane current in identified interneurons in C. elegans.
J Neurophysiol 2006 95(6) 3665-73
[ PubMed ID = 16554520 ] [ RRC reference ]