分離済み変異体

tm10945

Allele Nametm10945
BalanceRequest Available
OutCrossRequest Available
Sequence NameC45B2.6 C45B2.5 C45B2.7 C45B2.12 C45B2.9 C45B2.4 C45B2.11 C45B2.17 C45B2.14
Gene NameC45B2.6 C45B2.5 C45B2.7 C45B2.12 C45B2.9 C45B2.4 C45B2.11 C45B2.17 C45B2.14
Worm BaseAllele Name tm10945
Gene Name C45B2.6 C45B2.5 C45B2.7 C45B2.12 C45B2.9 C45B2.4 C45B2.11 C45B2.17 C45B2.14
Sequence C45B2.6 C45B2.5 C45B2.7 C45B2.12 C45B2.9 C45B2.4 C45B2.11 C45B2.17 C45B2.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9460/9461-29770/29771 (20310 bp deletion)
ChromosomeX
Putative gene structureC45B2.6 = join(6492..6608, 6844..6960, 7004..7233, 7289..7463, 7799..7910, 7955..8045, 8094..8190, 8235..8319, 8363..8632, 8682..8938, 9015..9268, 9317..9587, 10139..10294, 10344..10400); C45B2.5 = join(11674..11713, 11760..11900, 11948..12109, 12236..12510, 12569..12780, 12835..13033, 13322..13450); C45B2.7 = complement(join(14367..14488, 14537..14873, 14922..15208, 15260..15532, 15989..16186, 16230..16425, 16480..16846, 16970..17092, 17147..17553, 17601..17704, 18799..19069, 19115..19264, 19310..19357)); C45B2.12 = 19868..20133; C45B2.9 = complement(19956..20147); C45B2.4 = join(29016..29053, 29099..29217, 30688..30914, 31001..31145, 31200..31334, 31692..31794, 31848..32006, 32624..32679, 32927..32959, 33418..33548, 33867..33950, 34283..34469, 34560..34662, 34935..35055); C45B2.11 = complement(25049..25112); C45B2.17 = complement(27367..27542); C45B2.14 = complement(28212..28410)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:GGTTCGGGAGGTTCACAAGA,ExtFwd:ATCATTCTTCCCACCTGTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication