分離済み変異体

tm10795

Allele Nametm10795
BalanceRequest Available
OutCrossRequest Available
Sequence NameY42H9AR.2 Y42H9AR.5 Y42H9AR.3 Y42H9AR.4 Y42H9AR.1 F42G8.9 F42G8.8 F42G8.18 F42G8.19 F42G8.10 F42G8.6 F42G8.11 F42G8.12
Gene NameY42H9AR.2 Y42H9AR.5 Y42H9AR.3 Y42H9AR.4 Y42H9AR.1 F42G8.9 F42G8.8 F42G8.18 F42G8.19 F42G8.10 F42G8.6 F42G8.11 F42G8.12
Worm BaseAllele Name tm10795
Gene Name Y42H9AR.2 Y42H9AR.5 Y42H9AR.3 Y42H9AR.4 Y42H9AR.1 F42G8.9 F42G8.8 F42G8.18 F42G8.19 F42G8.10 F42G8.6 F42G8.11 F42G8.12
Sequence Y42H9AR.2 Y42H9AR.5 Y42H9AR.3 Y42H9AR.4 Y42H9AR.1 F42G8.9 F42G8.8 F42G8.18 F42G8.19 F42G8.10 F42G8.6 F42G8.11 F42G8.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y42H9AL]9663/9664-[F42G8]19029/19030 (38085 bp deletion)
ChromosomeIV
Putative gene structureY42H9AR.2= join(169..290, 719..875, 925..1047); Y42H9AR.5= join(2160..2208, 3386..3558, 3697..3834); Y42H9AR.3= complement(join(4104..4293, 4787..5209, 5260..5674, 5764..5925, 6299..6545, 6591..6788, 7165..7221)); Y42H9AR.4= complement(join(7923..8123, 8598..9184, 9564..9647, 9695..9909, 10352..10705, 10829..11073, 11565..11707, 11774..11828)); Y42H9AR.1= join(13129..13191, 13248..13405, 13454..13757, 13803..13976, 14086..14737, 14825..14994); F42G8.9= join(121..150, 763..871, 1336..1493, 1555..1720, 1984..2195, 2265..2517, 2569..2753); F42G8.8= join(3509..3589, 3784..3992, 4043..4118, 4508..4750, 4796..4893, 5048..5162, 5209..5292, 5400..5645); F42G8.18= 6216..6548; F42G8.7= join(9749..9759, 9819..9924, 10007..10705, 10989..11522); F42G8.19= join(12042..12089, 12652..12925, 12991..13217); F42G8.10= complement(join(13434..13497, 13883..13981, 14030..14169, 14240..14360, 14418..14539)); F42G8.6= join(14927..15017, 15060..15181, 15230..15321, 15381..15748, 15833..15996, 16042..16183, 16230..16459); F42G8.11= complement(join(16605..16706, 16753..17140, 17606..17724, 17781..17855)); F42G8.12= complement(join(18464..18538, 19143..19219, 19272..19527, 19573..19634, 19679..19822, 19867..19984, 20032..20088, 20307..20348))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:GCCGCTGTTAGTCACAGCAC,ExtFwd:CCTTTCCCTTAGCGTCCTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication