Home > Mutants (Isolated) > tm1078

Mutants (Isolated)

Allele Name		tm1078
Allele Type		Normal
Sequence Name		F58H1.1
Gene Name		aman-2
Worm Base	Allele Name	tm1078
	Gene Name	aman-2
	Sequence	F58H1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. I. Wilson: J. Biol. Chem. 281, 28265-28277.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4427/4428-4731/4732 (304 bp deletion)
Chromosome		V
Putative gene structure		complement(join(733..1015, 1067..1817, 2848..3139, 3191..3368, 3419..3797, 4341..4561, 4610..4954, 5002..5104, 5152..5605, 5648..5958, 6014..6128))
Map position		3.54
Balancer
Map position of balancer
Sequence of primers		IntFwd:AAGTTGCTCGCCAGACGCAG,ExtFwd:CTGTCCTGATGCTTACCACT,IntRev:CTGTGGTTCTCCAAAGTCAC,ExtRev:CTGTGCCGGAGAAACGGATT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69  [ PubMed ID = 38164610 ] [ RRC reference ] Rahman M, Ramirez-Suarez NJ, Diaz-Balzac CA, Bülow HE. Specific N-glycans regulate an extracellular adhesion complex during somatosensory dendrite patterning. EMBO Rep 2022 23(7) e54163  [ PubMed ID = 35586945 ] [ RRC reference ] Zárate-Potes A, Yang W, Pees B, Schalkowski R, Segler P, Andresen B, Haase D, Nakad R, Rosenstiel P, Tetreau G, Colletier JP, Schulenburg H, Dierking K. The C. elegans GATA transcription factor elt-2 mediates distinct transcriptional responses and opposite infection outcomes towards different Bacillus thuringiensis strains. PLoS Pathog 2020 16(9) e1008826  [ PubMed ID = 32970778 ] [ RRC reference ] Butschi A, Titz A, Wälti MA, Olieric V, Paschinger K, Nöbauer K, Guo X, Seeberger PH, Wilson IB, Aebi M, Hengartner MO, Künzler M. Caenorhabditis elegans N-glycan core beta-galactoside confers sensitivity towards nematotoxic fungal galectin CGL2. PLoS Pathog 2010 6(1) e1000717  [ PubMed ID = 20062796 ] [ RRC reference ] Wohlschlager T, Butschi A, Grassi P, Sutov G, Gauss R, Hauck D, Schmieder SS, Knobel M, Titz A, Dell A, Haslam SM, Hengartner MO, Aebi M, Künzler M. Methylated glycans as conserved targets of animal and fungal innate defense. Proc Natl Acad Sci U S A 2014 111(27) E2787-96  [ PubMed ID = 24879441 ] [ RRC reference ] Paschinger K, Gutternigg M, Rendić D, Wilson IB. The N-glycosylation pattern of Caenorhabditis elegans. Carbohydr Res 2008 343(12) 2041-9  [ PubMed ID = 18226806 ] [ RRC reference ] Rendić D, Wilson IB, Lubec G, Gutternigg M, Altmann F, Léonard R. Adaptation of the "in-gel release method" to N-glycome analysis of low-milligram amounts of material. Electrophoresis 2007 28(23) 4484-92  [ PubMed ID = 18041037 ] [ RRC reference ] Kato T, Kitamura K, Maeda M, Kimura Y, Katayama T, Ashida H, Yamamoto K. Free oligosaccharides in the cytosol of Caenorhabditis elegans are generated through endoplasmic reticulum-golgi trafficking. J Biol Chem 2007 282(30) 22080-8  [ PubMed ID = 17537729 ] [ RRC reference ] Paschinger K, Hackl M, Gutternigg M, Kretschmer-Lubich D, Stemmer U, Jantsch V, Lochnit G, Wilson IB. A deletion in the golgi alpha-mannosidase II gene of Caenorhabditis elegans results in unexpected non-wild-type N-glycan structures. J Biol Chem 2006 281(38) 28265-77  [ PubMed ID = 16864579 ] [ RRC reference ]