Mutants (Isolated)

tm1078

Allele Nametm1078
Sequence NameF58H1.1
CGC Nameaman-2
Worm BaseAllele Name tm1078
CGC Name aman-2
Sequence F58H1.1
Phenotypehomozygous viable. Dr. I. Wilson: J. Biol. Chem. 281, 28265-28277.
Mutation site4427/4428-4731/4732 (304 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(733..1015, 1067..1817, 2848..3139, 3191..3368, 3419..3797, 4341..4561, 4610..4954, 5002..5104, 5152..5605, 5648..5958, 6014..6128))
Map position3.54
Balancer
Map position of balancer
Sequence of primersIntFwd:AAGTTGCTCGCCAGACGCAG,ExtFwd:CTGTCCTGATGCTTACCACT,IntRev:CTGTGGTTCTCCAAAGTCAC,ExtRev:CTGTGCCGGAGAAACGGATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Paschinger K, Hackl M, Gutternigg M, Kretschmer-Lubich D, Stemmer U, Jantsch V, Lochnit G, Wilson IB.
A deletion in the golgi alpha-mannosidase II gene of Caenorhabditis elegans results in unexpected non-wild-type N-glycan structures.
J. Biol. Chem. 2006 281(38) 28265-77 
[ PubMed ID = 16864579 ] [ RRC reference ]

Rendić D, Wilson IB, Lubec G, Gutternigg M, Altmann F, Léonard R.
Adaptation of the "in-gel release method" to N-glycome analysis of low-milligram amounts of material.
Electrophoresis 2007 28(23) 4484-92 
[ PubMed ID = 18041037 ] [ RRC reference ]

Butschi A, Titz A, Wälti MA, Olieric V, Paschinger K, Nöbauer K, Guo X, Seeberger PH, Wilson IB, Aebi M, Hengartner MO, Künzler M.
Caenorhabditis elegans N-glycan core beta-galactoside confers sensitivity towards nematotoxic fungal galectin CGL2.
PLoS Pathog. 2010 6(1) e1000717 
[ PubMed ID = 20062796 ] [ RRC reference ]

Kato T, Kitamura K, Maeda M, Kimura Y, Katayama T, Ashida H, Yamamoto K.
Free oligosaccharides in the cytosol of Caenorhabditis elegans are generated through endoplasmic reticulum-golgi trafficking.
J. Biol. Chem. 2007 282(30) 22080-8 
[ PubMed ID = 17537729 ] [ RRC reference ]

Paschinger K, Gutternigg M, Rendić D, Wilson IB.
The N-glycosylation pattern of Caenorhabditis elegans.
Carbohydr. Res. 2008 343(12) 2041-9 
[ PubMed ID = 18226806 ] [ RRC reference ]

Wohlschlager T, Butschi A, Grassi P, Sutov G, Gauss R, Hauck D, Schmieder SS, Knobel M, Titz A, Dell A, Haslam SM, Hengartner MO, Aebi M, Künzler M.
Methylated glycans as conserved targets of animal and fungal innate defense.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(27) E2787-96 
[ PubMed ID = 24879441 ] [ RRC reference ]