Home > Mutants (Isolated) > tm10761

Mutants (Isolated)

tm10761

Allele Nametm10761
BalanceNot Required
OutCrossRequest Available
Sequence NameY54G11A.4 Y54G11A.7 Y54G11A.5 Y54G11A.6 Y54G11A.13 Y54G11A.14
Gene NameY54G11A.4 Y54G11A.7 Y54G11A.5 Y54G11A.6 Y54G11A.13 Y54G11A.14
Worm BaseAllele Name tm10761
Gene Name Y54G11A.4 Y54G11A.7 Y54G11A.5 Y54G11A.6 Y54G11A.13 Y54G11A.14
Sequence Y54G11A.4 Y54G11A.7 Y54G11A.5 Y54G11A.6 Y54G11A.13 Y54G11A.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 44517/44518-74681/74682 (30164 bp deletion)
ChromosomeII
Putative gene structureY54G11A.4= join(41286..41484, 41537..41702, 41753..41926, 41974..42169, 42777..43102, 43771..44088, 44321..44435); Y54G11A.7= join(45770..45968, 46014..46179, 46229..46402, 46723..46918, 46967..47313, 47676..47997); Y54G11A.5= complement(join(48119..48649, 49388..49660, 49712..50356, 0429..50482)); Y54G11A.6= complement(join(52083..52604, 53618..53890, 53945..54589, 54662..54715)); Y54G11A.13= complement(join(56316..56837, 57851..58123, 58178..58822, 58883..58950, 59175..59205)); Y54G11A.14= join(66620..67099, 67678..68165, 68217..68444, 69223..69379)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:GTCCGAGTAAAAGAATCCGA,ExtFwd:CTTTGCTCGTCGCGACTACG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication