分離済み変異体

tm10730

Allele Nametm10730
BalanceCompleted
OutCrossCompleted
Sequence NameY46G5A.31 F35C5.1 F35C5.2 F35C5.3 F35C5.4 F35C5.5 F35C5.6 F35C5.7 F35C5.8 F35C5.9
Gene NameY46G5A.31 F35C5.1 F35C5.2 F35C5.3 F35C5.4 F35C5.5 F35C5.6 F35C5.7 F35C5.8 F35C5.9
Worm BaseAllele Name tm10730 (x1)
Gene Name Y46G5A.31 F35C5.1 F35C5.2 F35C5.3 F35C5.4 F35C5.5 F35C5.6 F35C5.7 F35C5.8 F35C5.9
Sequence Y46G5A.31 F35C5.1 F35C5.2 F35C5.3 F35C5.4 F35C5.5 F35C5.6 F35C5.7 F35C5.8 F35C5.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y46G5A]192536/192537-[F35C5]28391/28392 (33663 bp deletion)
ChromosomeII
Putative gene structureY46G5A.31= complement(join(186134..186272, 187645..188023, 189688..189841, 190977..191558, 193219..193633, 195811..195992, 196644..196766, 197333..197377)); F35C5.1= join(2293..2396, 2761..2934, 3207..3326, 3374..3419); F35C5.2= join(6754..6993, 7040..7185, 7766..7841, 7890..8089, 8366..8552, 9879..10031); F35C5.3= join(10256..10321, 10369..10455, 10501..10557, 10605..11249, 11302..11355, 11411..11455, 11506..11547, 11595..11630, 11678..11710, 11762..11827, 11885..11938); F35C5.4= join(12108..12128, 12366..12551, 12916..12993, 13048..13095, 13141..13185, 13241..13279, 13338..13379, 13443..13502); F35C5.5= complement(join(14630..14815, 14862..14974, 15032..15229, 15289..15584, 15632..15735, 16263..16376, 16418..16576)); F35C5.6= join(17118..17665, 17998..18194, 18243..18553, 18686..18865); F35C5.7= join(19768..20234, 21007..21200, 21262..21459, 21520..21632, 21695..21880); F35C5.8= join(22810..22840, 22887..23113, 23171..23274, 23327..23610, 23816..24013, 24397..24506, 24560..24631, 24683..24775); F35C5.9= join(25897..25996, 26056..26282, 26357..26553, 26601..26791, 27503..27703, 27755..28023)
Map position
BalancermnC1 [dpy-10(e128) unc52(e444) nIs190 let-?]
Map position of balancer
Sequence of primersExtRev:CGAGCCTGTTACATTCCCAA,ExtFwd:TGCAATCCTGGGATGCATAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication