Mutants (Isolated)

tm1072

Allele Nametm1072
BalanceNot Required
OutCrossNot Accepted
Sequence NameR06C7.3
Gene Namedhp-1
Worm BaseAllele Name tm1072
Gene Name dhp-1
Sequence R06C7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8433/8434-9872/9873 (1439 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(7895..7963, 8094..8340, 8392..8457, 8905..9182, 9550..9761, 9840..10017, 10603..10783, 10885..10979, 11337..11645))
Map position1.85
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCGTGACAGTTGATTCCT,IntFwd:ATATCTGCATCGGAACCAAC,ExtRev:CGGATCATAGAAATGGGGAG,IntRev:ATGGGGAGTCATTGATTGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]