| Allele Name | tm1071 |
| Sequence Name | B0244.8 |
| CGC Name | egg-1 |
| Worm Base | Allele Name |
tm1071
|
| CGC Name |
egg-1
|
| Sequence |
B0244.8
|
| Phenotype | homozygous viable. Dr. A. Singson: Curr. Biol.15, 2222-2229 (2005). |
| Mutation site | 1797/1798-2213/2214 (416 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(1139..1204, 1707..1762, 1809..1890, 1935..2576, 2621..3332, 3384..3550) |
| Map position | -1.45 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:TTACGTCGGCTGATGCACAT,ExtRev:ACTCCATCGCATCGACGGCT,ExtFwd:CACATACATACAGGCGGTCT,IntFwd:ACATACCACCACGGCTACGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Choi S, Ambros V.
The C. elegans heterochronic gene lin-28 coordinates the timing of hypodermal and somatic gonadal programs for hermaphrodite reproductive system morphogenesis.
Development 2019 146(5)
[ PubMed ID = 30745431 ]
[ RRC reference ]
|
Johnston WL, Krizus A, Dennis JW.
Eggshell chitin and chitin-interacting proteins prevent polyspermy in C. elegans.
Curr. Biol. 2010 20(21) 1932-7
[ PubMed ID = 20971008 ]
[ RRC reference ]
|
Marcello MR, Singaravelu G, Singson A.
Fertilization.
Adv. Exp. Med. Biol. 2013 757 321-50
[ PubMed ID = 22872482 ]
[ RRC reference ]
|
Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv. Exp. Med. Biol. 2013 757 41-69
[ PubMed ID = 22872474 ]
[ RRC reference ]
|
Kadandale P, Stewart-Michaelis A, Gordon S, Rubin J, Klancer R, Schweinsberg P, Grant BD, Singson A.
The egg surface LDL receptor repeat-containing proteins EGG-1 and EGG-2 are required for fertilization in Caenorhabditis elegans.
Curr. Biol. 2005 15(24) 2222-9
[ PubMed ID = 16360684 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.