分離済み変異体

tm1071

Allele Nametm1071
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0244.8
Gene Nameegg-1
Worm BaseAllele Name tm1071
Gene Name egg-1
Sequence B0244.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Singson: Curr. Biol.15, 2222-2229 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1797/1798-2213/2214 (416 bp deletion)
ChromosomeIII
Putative gene structurejoin(1139..1204, 1707..1762, 1809..1890, 1935..2576, 2621..3332, 3384..3550)
Map position-1.45
Balancer
Map position of balancer
Sequence of primersIntRev:TTACGTCGGCTGATGCACAT,ExtRev:ACTCCATCGCATCGACGGCT,ExtFwd:CACATACATACAGGCGGTCT,IntFwd:ACATACCACCACGGCTACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Choi S, Ambros V.
The C. elegans heterochronic gene lin-28 coordinates the timing of hypodermal and somatic gonadal programs for hermaphrodite reproductive system morphogenesis.
Development 2019 146(5)  
[ PubMed ID = 30745431 ] [ RRC reference ]

Marcello MR, Singaravelu G, Singson A.
Fertilization.
Adv Exp Med Biol 2013 757 321-50 
[ PubMed ID = 22872482 ] [ RRC reference ]

Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv Exp Med Biol 2013 757 41-69 
[ PubMed ID = 22872474 ] [ RRC reference ]

Johnston WL, Krizus A, Dennis JW.
Eggshell chitin and chitin-interacting proteins prevent polyspermy in C. elegans.
Curr Biol 2010 20(21) 1932-7 
[ PubMed ID = 20971008 ] [ RRC reference ]

Kadandale P, Stewart-Michaelis A, Gordon S, Rubin J, Klancer R, Schweinsberg P, Grant BD, Singson A.
The egg surface LDL receptor repeat-containing proteins EGG-1 and EGG-2 are required for fertilization in Caenorhabditis elegans.
Curr Biol 2005 15(24) 2222-9 
[ PubMed ID = 16360684 ] [ RRC reference ]