Home > Mutants (Isolated) > tm10689

Mutants (Isolated)

tm10689

Allele Nametm10689
BalanceRequest Available
OutCrossRequest Available
Sequence NameT23B7.3 F11G11.7 F11G11.5 F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13 F11G11.3 F11G11.2 F11G11.1 R05F9.7
Gene NameT23B7.3 F11G11.7 F11G11.5 F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13 F11G11.3 F11G11.2 F11G11.1 R05F9.7
Worm BaseAllele Name tm10689
Gene Name T23B7.3 F11G11.7 F11G11.5 F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13 F11G11.3 F11G11.2 F11G11.1 R05F9.7
Sequence T23B7.3 F11G11.7 F11G11.5 F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13 F11G11.3 F11G11.2 F11G11.1 R05F9.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T23B7]1636/1637-[R05F9]2416/2417 (43782 bp deletion)
ChromosomeII
Putative gene structureF11G11.7= join(1746..1853, 1902..2432, 2480..2702, 2849..3609, 3970..4099, 4153..4175); F11G11.5= join(7622..7666, 7759..8110, 8212..8333, 8384..8536); F11G11.8= complement(9834..10049); F11G11.4= join(10764..11022, 11164..11291); F11G11.9= complement(join(12003..12274, 12323..12424, 12586..12664, 12714..13094)); F11G11.10= complement(join(16231..16329, 16377..17111)); F11G11.11= complement(join(19465..20267, 20396..20459)); F11G11.12= complement(join(21905..21951, 22004..22814)); F11G11.13= complement(join(24968..25129, 25175..25265, 25323..25390)); F11G11.3= join(29604..29736, 30186..30673); F11G11.2= join(31807..31939, 32492..32979); F11G11.1= join(33442..33574, 33751..34238); R05F9.7= join(1819..2155, 3139..3200, 3249..3596, 3641..3754)
Map position-2.99
Balancer
Map position of balancer
Sequence of primersExtRev:TTCCCGCTACGAGGAGATAC,ExtFwd:ACAAGTCGGCATACATGGGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication