Home > Mutants (Isolated) > tm10686

Mutants (Isolated)

tm10686

Allele Nametm10686
BalanceCompleted
OutCrossCompleted
Sequence NameC55B6.4 C55B6.7 C55B6.2 C55B6.1 C55B6.5 ZK867.2 ZK867.3 ZK867.1 F46H5.3
Gene NameC55B6.4 C55B6.7 C55B6.2 C55B6.1 C55B6.5 ZK867.2 ZK867.3 ZK867.1 F46H5.3
Worm BaseAllele Name tm10686 (x1)
Gene Name C55B6.4 C55B6.7 C55B6.2 C55B6.1 C55B6.5 ZK867.2 ZK867.3 ZK867.1 F46H5.3
Sequence C55B6.4 C55B6.7 C55B6.2 C55B6.1 C55B6.5 ZK867.2 ZK867.3 ZK867.1 F46H5.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F43E12]9115/9116-[F46H5]4656/4657 (56041 bp deletion)
ChromosomeX
Putative gene structureC55B6.4= complement(join(6889..6951, 7000..7247, 7392..7498, 7985..8016)); C55B6.7= complement(join(11201..11206, 11256..11420)); C55B6.2= join(14114..14159, 14210..14280, 14327..14494, 14619..14693, 14743..15068, 15769..15857, 15910..16164, 16221..16502, 16745..16823, 17268..17352); C55B6.1= join(19921..20031, 20086..20185, 20812..20887, 20937..21030, 21077..21346, 21399..21545, 21593..21719, 21950..22220, 22924..23019, 23078..23357); C55B6.5= complement(join(24276..24351, 24400..24627, 24737..24741)); ZK867.2= join(1450..1590, 1632..1725, 2153..2241, 2927..3086, 3133..3283, 4458..4707, 6438..6572, 6628..6708, 7065..7274); ZK867.1= join(13199..13336, 15704..15830, 15877..16348, 16407..16522, 18602..18672, 18724..18943, 20173..20363, 20498..20776); F46H5.3= complement(join(225..714, 767..1092, 1430..1636, 1692..1802))
Map position-1.8
BalancertmC30[tmIs1247]
Map position of balancer
Sequence of primersExtRev:TGCACACCCCACTTTAATAG,ExtFwd:TCGTGTTCGGCTTACAGCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication