分離済み変異体

tm10593

Allele Nametm10593
BalanceNot Required
OutCrossRequest Available
Sequence NameF11A5.10 F11A5.12 F11A5.14 F11A5.13 F21H7.2 F21H7.12 F21H7.1 F21H7.3 F21H7.4 F21H7.14 F21H7.5 F21H7.7 F21H7.11 F21H7.9
Gene NameF11A5.10 F11A5.12 F11A5.14 F11A5.13 F21H7.2 F21H7.12 F21H7.1 F21H7.3 F21H7.4 F21H7.14 F21H7.5 F21H7.7 F21H7.11 F21H7.9
Worm BaseAllele Name tm10593
Gene Name F11A5.10 F11A5.12 F11A5.14 F11A5.13 F21H7.2 F21H7.12 F21H7.1 F21H7.3 F21H7.4 F21H7.14 F21H7.5 F21H7.7 F21H7.11 F21H7.9
Sequence F11A5.10 F11A5.12 F11A5.14 F11A5.13 F21H7.2 F21H7.12 F21H7.1 F21H7.3 F21H7.4 F21H7.14 F21H7.5 F21H7.7 F21H7.11 F21H7.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F11A5]29964/29965-[F21H7]26489/26490 (33868 bp deletion)
ChromosomeV
Putative gene structureF11A5.10= join(29616..29686, 29840..29921, 30041..30711, 31009..31292, 31459..31736); F11A5.12= join(34240..34390, 34500..34849, 34897..35013, 35059..35388); F11A5.14= complement(35607..35793); F11A5.13= complement(join(35985..36216, 36269..36512, 36566..36587)); F21H7.2= complement(join(Z92830.1:37060..37177, Z92830.1:37225..37346, 52..130, 181..429, 477..579, 725..887, 934..990, 1038..1169, 1217..1363, 1425..1520, 1822..2059, 2110..2132)); F21H7.12= join(2771..3126,3351..3561); F21H7.1= complement(join(3651..4147, 4675..4834)); F21H7.3= complement(join(5258..5471, 5520..5818)); F21H7.4= join(6487..6843, 6890..7200, 7244..7424); F21H7.14= complement(join(7734..7798, 7866..8504, 8886..9246)); F21H7.5= join(10178..10261, 10309..10662, 10715..10972, 11051..11275); F21H7.7= complement(join(15386..16116, 16378..16741)); F21H7.11= join(19442..19796, 20258..21018); F21H7.9= complement(join(21146..21441, 21503..21601, 21725..21899, 21943..22135, 22557..22792, 22837..23662, 24107..24300, 24349..24618, 24702..24824, 24906..25027, 25077..25202, 25244..25470, 25570..25812, 26154..26350))
Map position9.85
Balancer
Map position of balancer
Sequence of primersExtRev:TCTCATAGGGGCATCAAGCA,ExtFwd:GCCCAACAAGCTAGGTACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication