Home > Mutants (Isolated) > tm10590

Mutants (Isolated)

tm10590

Allele Nametm10590
BalanceNot Required
OutCrossRequest Available
Sequence NameW02B3.2 C24A1.2 C24A1.3 W02B3.4 W02B3.7 C24A1.8
Gene NameW02B3.2 C24A1.2 C24A1.3 W02B3.4 W02B3.7 C24A1.8
Worm BaseAllele Name tm10590
Gene Name W02B3.2 C24A1.2 C24A1.3 W02B3.4 W02B3.7 C24A1.8
Sequence W02B3.2 C24A1.2 C24A1.3 W02B3.4 W02B3.7 C24A1.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [W02B3]12544/12545-[C24A1]7485/7486 (20341 bp deletion)
ChromosomeIII
Putative gene structureC24A1.3= complement(join(320..823, 867..984, 1234..1359, 1402..1448, 1495..1695, 1743..2224, 2277..2627, 2889..3021, 3191..3629, 3793..3904, 4045..4084)); C24A1.2= join(14193..14357, 14917..15033, 15857..15956, 16818..17000, 21048..21179, 21943..22397, 23181..23291); W02B3.2= join(9292..9555, 9606..9707, 9756..10036, 10371..10778, 11219..11560, 11834..12102, 12152..12285, 12334..12456, 13010..13210); W02B3.4= complement(join(14059..14196, 14244..14353, 14513..14639, 14689..14931, 15130..15256, 15305..15438, 15755..15892, 16346..16492)); W02B3.7= complement(join(24339..24596, 24652..24783, 24882..24980))
Map position-26.29
Balancer
Map position of balancer
Sequence of primersIntRev:CCCAGGGAGAGTTGGCCATA,ExtRev:ATTCTCAGGAGTTCTATGCG,IntFwd:AAGCCAGAGGTACGTTTGAT,ExtFwd:CTATCCATCTCGACTGGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication