| Allele Name | tm1051 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K09C8.4 |
| Gene Name | lge-1 |
| Worm Base | Allele Name |
tm1051
|
| Gene Name |
lge-1
|
| Sequence |
K09C8.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. McIntire: normal development and locomotion. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 19883/19884-TG-20256/20257 (373 bp deletion + 2 bp insertion) |
| Chromosome | X |
| Putative gene structure | join(17344..17421, 17486..17794, 17838..17996, 18611..18742, 19076..19525, 19571..19760, 19806..19960, 20007..20105, 20137..20264, 20311..20479) |
| Map position | 2.77 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CTATGTCCGGAGACTCCACT,IntFwd:GACTCCACTTGCGCTACATT,ExtRev:CGACTACGTGTCGACACTTA,IntRev:GTGTTGCAGTGCCCAACGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Johnson RP, Kramer JM. C. elegans dystroglycan coordinates responsiveness of follower axons to dorsal/ventral and anterior/posterior guidance cues. Dev Neurobiol 2012 72(12) 1498-515
[ PubMed ID = 22275151 ]
[ RRC reference ]
|
Johnson RP, Kramer JM. Neural maintenance roles for the matrix receptor dystroglycan and the nuclear anchorage complex in Caenorhabditis elegans. Genetics 2012 190(4) 1365-77
[ PubMed ID = 22298703 ]
[ RRC reference ]
|
|