分離済み変異体

tm10464

Allele Nametm10464
BalanceNot Required
OutCrossRequest Available
Sequence NameF11E6.5 C06A12.4 F11E6.2 C30H6.6 4R79.1 T02D1.5 T02D1.3 C30H6.2 4R79.2
Gene NameF11E6.5 C06A12.4 F11E6.2 C30H6.6 4R79.1 T02D1.5 T02D1.3 C30H6.2 4R79.2
Worm BaseAllele Name tm10464
Gene Name F11E6.5 C06A12.4 F11E6.2 C30H6.6 4R79.1 T02D1.5 T02D1.3 C30H6.2 4R79.2
Sequence F11E6.5 C06A12.4 F11E6.2 C30H6.6 4R79.1 T02D1.5 T02D1.3 C30H6.2 4R79.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C49C3]27676/27677-[4R79]12689/12690 (152928 bp deletion)
ChromosomeIV
Putative gene structureF11E6.5= complement(join(24281..24401, 24524..24679, 24741..24993, 25046..25226, 25302..25415)); C06A12.4= complement(join(30819..30910, 30966..31191, 31334..31480, 31533..31592, 31636..31759, 32122..32262, 32322..32490, 32708..32899, 33259..33433, 33529..33600, 33649..33936, 33980..34061, 34400..34473)); F11E6.2= complement(join(33501..33692, 33735..33854)); C30H6.6= join(24790..24939, 24984..25092, 25545..25772, 25825..26162, 26211..26357, 26405..26486, 26531..27111, 27158..27357, 27401..27599); 4R79.2= complement(join(1525..1618, 1662..1738, 2291..2516, 2592..2720, 2766..3038, 3093..3208, 3438..3490, 3538..3646, 4063..4116, 4403..4459)); 4R79.1= complement(join(8111..8250, 8353..8473, 8525..8680, 9208..9293, 9358..9488, 9537..9654, 10112..10199, 10244..10296, 11485..11626)); T02D1.3= join(9318..9548, 9620..9829, 9979..10137, 10185..10382, 10429..10599); T02D1.5= complement(join(15685..15916, 16026..16151, 16256..16537, 16584..16678, 16725..16822, 16876..17154, 17201..17381, 17428..17656, 17704..17852, 17907..18059, 18296..18387, 18443..18731)); C30H6.2= complement(join(13234..13368, 13413..13745, 13794..14039, 14085..14198, 14314..14445, 14564..14636, 14684..14811))
Map position17.1
Balancer
Map position of balancer
Sequence of primersIntRev:CGGGCCTAGTGGACTAGAAA,ExtRev:TTGTCCACTACGCGGGCCTA,IntFwd:GACGCAGAAAGCTGTAAGTC,ExtFwd:ATGTCCTCCCTCGTTAAATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication