分離済み変異体

tm1046

Allele Nametm1046
BalanceNot Required
OutCrossNot Accepted
Sequence NameK04G7.3
Gene Nameogt-1
Worm BaseAllele Name tm1046
Gene Name ogt-1
Sequence K04G7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Satterlee: normal brood size, development and movement.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6538/6539-7004/7005 (466 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(3546..3720, 3770..3893, 4529..4646, 4692..4985, 5042..5872, 5941..6579, 6825..6969, 7022..7308, 7359..7671, 7718..7871, 7923..8094, 10451..10618, 10812..10847))
Map position-0.78
Balancer
Map position of balancer
Sequence of primersIntFwd:AGCGTGGATGAGTGGTGTCT,ExtFwd:ATCCGGAGGCGCTGTCCATT,IntRev:CCGCAGCTTTGGTGTCTGGT,ExtRev:CAACGCTATTGCTCCTCTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Suthakaran N, Wiggins J, Giles A, Opperman KJ, Grill B, Dawson-Scully K.
O-GlcNAc transferase OGT-1 and the ubiquitin ligase EEL-1 modulate seizure susceptibility in C. elegans.
PLoS One 2021 16(11) e0260072 
[ PubMed ID = 34797853 ] [ RRC reference ]

Ardiel EL, McDiarmid TA, Timbers TA, Lee KCY, Safaei J, Pelech SL, Rankin CH.
Insights into the roles of CMK-1 and OGT-1 in interstimulus interval-dependent habituation in Caenorhabditis elegans.
Proc Biol Sci 2018 285(1891)  
[ PubMed ID = 30429311 ] [ RRC reference ]

Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z, Feng D, Chen S, Zhang H.
O-GlcNAc-modification of SNAP-29 regulates autophagosome maturation.
Nat Cell Biol 2014 16(12) 1215-26 
[ PubMed ID = 25419848 ] [ RRC reference ]

Ghosh SK, Bond MR, Love DC, Ashwell GG, Krause MW, Hanover JA.
Disruption of O-GlcNAc Cycling in C. elegans Perturbs Nucleotide Sugar Pools and Complex Glycans.
Front Endocrinol (Lausanne) 2014 5 197 
[ PubMed ID = 25505447 ] [ RRC reference ]

Mondoux MA, Love DC, Ghosh SK, Fukushige T, Bond M, Weerasinghe GR, Hanover JA, Krause MW.
O-linked-N-acetylglucosamine cycling and insulin signaling are required for the glucose stress response in Caenorhabditis elegans.
Genetics 2011 188(2) 369-82 
[ PubMed ID = 21441213 ] [ RRC reference ]

Love DC, Ghosh S, Mondoux MA, Fukushige T, Wang P, Wilson MA, Iser WB, Wolkow CA, Krause MW, Hanover JA.
Dynamic O-GlcNAc cycling at promoters of Caenorhabditis elegans genes regulating longevity, stress, and immunity.
Proc Natl Acad Sci U S A 2010 107(16) 7413-8 
[ PubMed ID = 20368426 ] [ RRC reference ]