| Allele Name | tm1045 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F55A11.5 |
| Gene Name | bus-18 |
| Worm Base | Allele Name |
tm1045
|
| Gene Name |
bus-18
|
| Sequence |
F55A11.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. Tuck: no effects on maa-1 mutant. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10864/10865-11791/11972 (927 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(10669..10725, 10883..10980, 11274..11644, 12072..12211, 12256..12368, 12417..12616, 12675..12719, 12770..13065) |
| Map position | 3.38 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TCGAGGAGGAAACACCTTCT,IntFwd:CGTCCATTACTCGGATGGTT,ExtRev:CTACTTGCATCCTGCTCGTT,IntRev:AATGGACTTCTCGTGGACTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Imae R, Inoue T, Nakasaki Y, Uchida Y, Ohba Y, Kono N, Nakanishi H, Sasaki T, Mitani S, Arai H. LYCAT, a homologue of C. elegans acl-8, acl-9, and acl-10, determines the fatty acid composition of phosphatidylinositol in mice. J Lipid Res 2012 53(3) 335-347
[ PubMed ID = 22172515 ]
[ RRC reference ]
|
Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H. Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol. Mol Biol Cell 2010 21(18) 3114-24
[ PubMed ID = 20668164 ]
[ RRC reference ]
|
Gravato-Nobre MJ, Hodgkin J. The acyltransferase gene bus-1 exhibits conserved and specific expression in nematode rectal cells and reveals pathogen-induced cell swelling. Dev Dyn 2008 237(12) 3762-76
[ PubMed ID = 19035336 ]
[ RRC reference ]
|
|