分離済み変異体

tm1045

Allele Nametm1045
BalanceNot Required
OutCrossNot Accepted
Sequence NameF55A11.5
Gene Namebus-18
Worm BaseAllele Name tm1045
Gene Name bus-18
Sequence F55A11.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Tuck: no effects on maa-1 mutant.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10864/10865-11791/11972 (927 bp deletion)
ChromosomeV
Putative gene structurejoin(10669..10725, 10883..10980, 11274..11644, 12072..12211, 12256..12368, 12417..12616, 12675..12719, 12770..13065)
Map position3.38
Balancer
Map position of balancer
Sequence of primersExtFwd:TCGAGGAGGAAACACCTTCT,IntFwd:CGTCCATTACTCGGATGGTT,ExtRev:CTACTTGCATCCTGCTCGTT,IntRev:AATGGACTTCTCGTGGACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Imae R, Inoue T, Nakasaki Y, Uchida Y, Ohba Y, Kono N, Nakanishi H, Sasaki T, Mitani S, Arai H.
LYCAT, a homologue of C. elegans acl-8, acl-9, and acl-10, determines the fatty acid composition of phosphatidylinositol in mice.
J Lipid Res 2012 53(3) 335-347 
[ PubMed ID = 22172515 ] [ RRC reference ]

Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H.
Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol.
Mol Biol Cell 2010 21(18) 3114-24 
[ PubMed ID = 20668164 ] [ RRC reference ]

Gravato-Nobre MJ, Hodgkin J.
The acyltransferase gene bus-1 exhibits conserved and specific expression in nematode rectal cells and reveals pathogen-induced cell swelling.
Dev Dyn 2008 237(12) 3762-76 
[ PubMed ID = 19035336 ] [ RRC reference ]