Mutants (Isolated)

tm1037

Allele Nametm1037
BalanceNot Required
OutCrossNot Accepted
Sequence NameT02G5.8
Gene Namekat-1
Worm BaseAllele Name tm1037
Gene Name kat-1
Sequence T02G5.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvkun: elevation of Nile Red staining. Dr. H.R. Horvitz: slightly elevated staining with Nile Red dye, which may indicate increased lipid accumulation. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. K. Ashrafi: increased Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4693/4694-AGAGAAGACTTCAAAAGAAATGGGAATTG-5210/5211 (517 bp deletion + 29 bp insertion)
ChromosomeII
Putative gene structurejoin(4483..4692, 4795..5058, 5155..5307, 5358..5493, 5543..5882, 5957..6077)
Map position0.49
Balancer
Map position of balancer
Sequence of primersIntRev:CCATGTGGGTTCACAAGGGA,ExtRev:GCAACATACCCGATGGGGTG,IntFwd:TAGGAGTATCGAAACCGCCA,ExtFwd:AGGAGCTCCTAGGAGTATCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bandi S, Schlemper-Scheidt MD, Rivera Sánchez R, Sutour S, Glauser G, Ishida Y, von Reuß SH.
Glycosylated N‑Acyl Phosphoethanolamines as Bacterial Food-Dependent Signaling Molecules in Caenorhabditis Nematodes.
ACS Bio Med Chem Au 2025 5(4) 602-619 
[ PubMed ID = 40860022 ] [ RRC reference ]

Labarre A, Guitard E, Tossing G, Forest A, Bareke E, Labrecque M, Tétreault M, Ruiz M, Alex Parker J.
Fatty acids derived from the probiotic Lacticaseibacillus rhamnosus HA-114 suppress age-dependent neurodegeneration.
Commun Biol 2022 5(1) 1340 
[ PubMed ID = 36477191 ] [ RRC reference ]

Midkiff DF, Huayta J, Lichty JD, Crapster JP, San-Miguel A.
Identifying C. elegans lifespan mutants by screening for early-onset protein aggregation.
iScience 2022 25(11) 105460 
[ PubMed ID = 36388964 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358 
[ PubMed ID = 28839231 ] [ RRC reference ]

Barros AG, Bridi JC, de Souza BR, de Castro Júnior C, de Lima Torres KC, Malard L, Jorio A, de Miranda DM, Ashrafi K, Romano-Silva MA.
Dopamine signaling regulates fat content through β-oxidation in Caenorhabditis elegans.
PLoS One 2014 9(1) e85874 
[ PubMed ID = 24465759 ] [ RRC reference ]

Berdichevsky A, Nedelcu S, Boulias K, Bishop NA, Guarente L, Horvitz HR.
3-Ketoacyl thiolase delays aging of Caenorhabditis elegans and is required for lifespan extension mediated by sir-2.1.
Proc Natl Acad Sci U S A 2010 107(44) 18927-32 
[ PubMed ID = 20956318 ] [ RRC reference ]

Mak HY, Nelson LS, Basson M, Johnson CD, Ruvkun G.
Polygenic control of Caenorhabditis elegans fat storage.
Nat Genet 2006 38(3) 363-8 
[ PubMed ID = 16462744 ] [ RRC reference ]