| Allele Name | tm1031 |
| Balance | Request Available |
| OutCross | Not Accepted |
| Sequence Name | F54D12.6 |
| Gene Name | rog-1 |
| Worm Base | Allele Name |
tm1031
|
| Gene Name |
rog-1
|
| Sequence |
F54D12.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10640/10641-T-11156/11157 (516 bp deletion + 1 bp insertion) |
| Chromosome | II |
| Putative gene structure | complement(join(10340..10576, 11055..11248, 11480..11636)) |
| Map position | -15.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CTGACAGGTGTTCTGTGTAT,ExtRev:GTAGTCCGTCTGACAGGTGT,IntFwd:CTGCCGTACCGAAAACCGAT,ExtFwd:TGTAGTTTGTAGTCTGCCGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Lo TW, Bennett DC, Goodman SJ, Stern MJ.
Caenorhabditis elegans fibroblast growth factor receptor signaling can occur independently of the multi-substrate adaptor FRS2.
Genetics 2010 185(2) 537-47
[ PubMed ID = 20308281 ]
[ RRC reference ]
|
Matsubara Y, Kawasaki I, Urushiyama S, Yasuda T, Shirakata M, Iino Y, Shibuya H, Yamanashi Y.
The adaptor-like protein ROG-1 is required for activation of the Ras-MAP kinase pathway and meiotic cell cycle progression in Caenorhabditis elegans.
Genes Cells 2007 12(3) 407-20
[ PubMed ID = 17352744 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.