Mutants (Isolated)

tm1031

Allele Nametm1031
Sequence NameF54D12.6
CGC Namerog-1
Worm BaseAllele Name tm1031
CGC Name rog-1
Sequence F54D12.6
Phenotypelethal or sterile
Mutation site10640/10641-T-11156/11157 (516 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(10340..10576, 11055..11248, 11480..11636))
Map position-15.47
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CTGACAGGTGTTCTGTGTAT,ExtFwd:TGTAGTTTGTAGTCTGCCGT,IntFwd:CTGCCGTACCGAAAACCGAT,ExtRev:GTAGTCCGTCTGACAGGTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Matsubara Y, Kawasaki I, Urushiyama S, Yasuda T, Shirakata M, Iino Y, Shibuya H, Yamanashi Y.
The adaptor-like protein ROG-1 is required for activation of the Ras-MAP kinase pathway and meiotic cell cycle progression in Caenorhabditis elegans.
Genes Cells 2007 12(3) 407-20 
[ PubMed ID = 17352744 ] [ RRC reference ]

Lo TW, Bennett DC, Goodman SJ, Stern MJ.
Caenorhabditis elegans fibroblast growth factor receptor signaling can occur independently of the multi-substrate adaptor FRS2.
Genetics 2010 185(2) 537-47 
[ PubMed ID = 20308281 ] [ RRC reference ]