分離済み変異体

tm1019

Allele Nametm1019
BalanceNot Required
OutCrossNot Accepted
Sequence NameF58G1.1
Gene NameF58G1.1
Worm BaseAllele Name tm1019
Gene Name F58G1.1
Sequence F58G1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9529/9530-CTG-10100/10101 (571 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurejoin(7992..8147, 8200..8390, 8436..8604, 8649..9054, 9101..9827, 9873..10048, 10095..10263, 10313..10487, 10531..10776, 10817..11181, 11230..11347)
Map position13.34
Balancer
Map position of balancer
Sequence of primersExtRev:CATTGGGGTTTAGAACTCCT,IntRev:ATACTTGGTTCCAGCAGGTG,ExtFwd:GTTCCGACTCAACCGTTAAG,IntFwd:ACGTCTAACGACGCTTGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587 
[ PubMed ID = 39055986 ] [ RRC reference ]

Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262 
[ PubMed ID = 37141255 ] [ RRC reference ]

Charlesworth AG, Seroussi U, Lehrbach NJ, Renaud MS, Sundby AE, Molnar RI, Lao RX, Willis AR, Woock JR, Aber MJ, Diao AJ, Reinke AW, Ruvkun G, Claycomb JM.
Two isoforms of the essential C. elegans Argonaute CSR-1 differentially regulate sperm and oocyte fertility.
Nucleic Acids Res 2021 49(15) 8836-8865 
[ PubMed ID = 34329465 ] [ RRC reference ]

Watts JS, Harrison HF, Omi S, Guenthers Q, Dalelio J, Pujol N, Watts JL.
New Strains for Tissue-Specific RNAi Studies in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 4167-4176 
[ PubMed ID = 32943454 ] [ RRC reference ]

Ouyang JPT, Folkmann A, Bernard L, Lee CY, Seroussi U, Charlesworth AG, Claycomb JM, Seydoux G.
P Granules Protect RNA Interference Genes from Silencing by piRNAs.
Dev Cell 2019 50(6) 716-728.e6 
[ PubMed ID = 31402283 ] [ RRC reference ]

Lev I, Toker IA, Mor Y, Nitzan A, Weintraub G, Antonova O, Bhonkar O, Ben Shushan I, Seroussi U, Claycomb JM, Anava S, Gingold H, Zaidel-Bar R, Rechavi O.
Germ Granules Govern Small RNA Inheritance.
Curr Biol 2019 29(17) 2880-2891.e4 
[ PubMed ID = 31378614 ] [ RRC reference ]

Xu F, Feng X, Chen X, Weng C, Yan Q, Xu T, Hong M, Guang S.
A Cytoplasmic Argonaute Protein Promotes the Inheritance of RNAi.
Cell Rep 2018 23(8) 2482-2494 
[ PubMed ID = 29791857 ] [ RRC reference ]

Wan G, Fields BD, Spracklin G, Shukla A, Phillips CM, Kennedy S.
Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance.
Nature 2018 557(7707) 679-683 
[ PubMed ID = 29769721 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat Genet 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

Corrêa RL, Steiner FA, Berezikov E, Ketting RF.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
PLoS Genet 2010 6(4) e1000903 
[ PubMed ID = 20386745 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]