Mutants (Isolated)

tm1019

Allele Nametm1019
Sequence NameF58G1.1
CGC NameF58G1.1
Worm BaseAllele Name tm1019
CGC Name F58G1.1
Sequence F58G1.1
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site9529/9530-CTG-10100/10101 (571 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurejoin(7992..8147, 8200..8390, 8436..8604, 8649..9054, 9101..9827, 9873..10048, 10095..10263, 10313..10487, 10531..10776, 10817..11181, 11230..11347)
Map position13.34
Balancer
Map position of balancer
Sequence of primersExtRev:CATTGGGGTTTAGAACTCCT,IntRev:ATACTTGGTTCCAGCAGGTG,ExtFwd:GTTCCGACTCAACCGTTAAG,IntFwd:ACGTCTAACGACGCTTGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Corrêa RL, Steiner FA, Berezikov E, Ketting RF.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
PLoS Genet. 2010 6(4) e1000903 
[ PubMed ID = 20386745 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat. Genet. 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol. Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]