Mutants (Isolated)

tm1011

Allele Nametm1011
Sequence NameH10E21.3a
CGC Namenhr-80
Worm BaseAllele Name tm1011
CGC Name nhr-80
Sequence H10E21.3a
Phenotypehomozygous viable. Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006).
Mutation site9565/9566-10011/10012 (446 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(8283..8495, 8570..8721, 9059..9485, 9558..9776, 9906..10177, 10616..10847))
Map position13.22
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCGCAGGCATGATCTCGT,IntFwd:CCCCACTGATATCCGTCTCA,ExtRev:GTATCTACACGGAGGCGCAG,IntRev:GCGGCATCATATCAACAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shen Y, Wollam J, Magner D, Karalay O, Antebi A.
A steroid receptor-microRNA switch regulates life span in response to signals from the gonad.
Science 2012 338(6113) 1472-6 
[ PubMed ID = 23239738 ] [ RRC reference ]

Pathare PP, Lin A, Bornfeldt KE, Taubert S, Van Gilst MR.
Coordinate regulation of lipid metabolism by novel nuclear receptor partnerships.
PLoS Genet. 2012 8(4) e1002645 
[ PubMed ID = 22511885 ] [ RRC reference ]

Webster CM, Deline ML, Watts JL.
Stress response pathways protect germ cells from omega-6 polyunsaturated fatty acid-mediated toxicity in Caenorhabditis elegans.
Dev. Biol. 2013 373(1) 14-25 
[ PubMed ID = 23064027 ] [ RRC reference ]

Zheng S, Liao S, Zou Y, Qu Z, Shen W, Shi Y.
Mulberry leaf polyphenols delay aging and regulate fat metabolism via the germline signaling pathway in Caenorhabditis elegans.
Age (Dordr) 2014 36(6) 9719 
[ PubMed ID = 25323576 ] [ RRC reference ]

Angeli S, Klang I, Sivapatham R, Mark K, Zucker D, Bhaumik D, Lithgow GJ, Andersen JK.
A DNA synthesis inhibitor is protective against proteotoxic stressors via modulation of fertility pathways in Caenorhabditis elegans.
Aging (Albany NY) 2013 5(10) 759-69 
[ PubMed ID = 24123581 ] [ RRC reference ]

Shemesh N, Shai N, Ben-Zvi A.
Germline stem cell arrest inhibits the collapse of somatic proteostasis early in Caenorhabditis elegans adulthood.
Aging Cell 2013 12(5) 814-22 
[ PubMed ID = 23734734 ] [ RRC reference ]

Sinha A, Rae R.
A functional genomic screen for evolutionarily conserved genes required for lifespan and immunity in germline-deficient C. elegans.
PLoS ONE 2014 9(8) e101970 
[ PubMed ID = 25093668 ] [ RRC reference ]

Svensk E, Ståhlman M, Andersson CH, Johansson M, Borén J, Pilon M.
PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.
PLoS Genet. 2013 9(9) e1003801 
[ PubMed ID = 24068966 ] [ RRC reference ]

Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H.
Fatty acid desaturation links germ cell loss to longevity through NHR-80/HNF4 in C. elegans.
PLoS Biol. 2011 9(3) e1000599 
[ PubMed ID = 21423649 ] [ RRC reference ]

Folick A, Oakley HD, Yu Y, Armstrong EH, Kumari M, Sanor L, Moore DD, Ortlund EA, Zechner R, Wang MC.
Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans.
Science 2015 347(6217) 83-6 
[ PubMed ID = 25554789 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Brock TJ, Browse J, Watts JL.
Genetic regulation of unsaturated fatty acid composition in C. elegans.
PLoS Genet. 2006 2(7) e108 
[ PubMed ID = 16839188 ] [ RRC reference ]

Lin CJ, Wang MC.
Microbial metabolites regulate host lipid metabolism through NR5A-Hedgehog signalling.
Nat. Cell Biol. 2017 19(5) 550-557 
[ PubMed ID = 28436966 ] [ RRC reference ]