分離済み変異体

tm1011

Allele Name

tm1011

Allele Type

通常株

Sequence Name

H10E21.3a

Gene Name

nhr-80

Worm Base

Allele Name

tm1011

Gene Name

nhr-80

Sequence

H10E21.3a

Phenotype

homozygous viable. Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006).

Mutation site

9565/9566-10011/10012 (446 bp deletion)

Chromosome

Putative gene structure

complement(join(8283..8495, 8570..8721, 9059..9485, 9558..9776, 9906..10177, 10616..10847))

Map position

13.22

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CATCGCAGGCATGATCTCGT,IntFwd:CCCCACTGATATCCGTCTCA,ExtRev:GTATCTACACGGAGGCGCAG,IntRev:GCGGCATCATATCAACAATC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)
[ PubMed ID = 36553826 ] [ RRC reference ]

Tan L, Zheng ZY, Huang L, Jin Z, Li SL, Wu GS, Luo HR.
Flavonol glycoside complanatoside A requires FOXO/DAF-16, NRF2/SKN-1, and HSF-1 to improve stress resistances and extend the life span of Caenorhabditis elegans.
Front Pharmacol 2022 13 931886
[ PubMed ID = 36071837 ] [ RRC reference ]

Savini M, Folick A, Lee YT, Jin F, Cuevas A, Tillman MC, Duffy JD, Zhao Q, Neve IA, Hu PW, Yu Y, Zhang Q, Ye Y, Mair WB, Wang J, Han L, Ortlund EA, Wang MC.
Lysosome lipid signalling from the periphery to neurons regulates longevity.
Nat Cell Biol 2022 24(6) 906-916
[ PubMed ID = 35681008 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122
[ PubMed ID = 36342299 ] [ RRC reference ]

Zeng WY, Tan L, Han C, Zheng ZY, Wu GS, Luo HR, Li SL.
Trigonelline Extends the Lifespan of C. Elegans and Delays the Progression of Age-Related Diseases by Activating AMPK, DAF-16, and HSF-1.
Oxid Med Cell Longev 2021 2021 7656834
[ PubMed ID = 34616504 ] [ RRC reference ]

Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q.
Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans.
Nat Commun 2022 13(1) 768
[ PubMed ID = 35140229 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ] [ RRC reference ]

Mony VK, Drangowska-Way A, Albert R, Harrison E, Ghaddar A, Horak MK, Ke W, O'Rourke EJ.
Context-specific regulation of lysosomal lipolysis through network-level diverting of transcription factor interactions.
Proc Natl Acad Sci U S A 2021 118(41)
[ PubMed ID = 34607947 ] [ RRC reference ]

Pérez-Jiménez MM, Monje-Moreno JM, Brokate-Llanos AM, Venegas-Calerón M, Sánchez-García A, Sansigre P, Valladares A, Esteban-García S, Suárez-Pereira I, Vitorica J, Ríos JJ, Artal-Sanz M, Carrión ÁM, Muñoz MJ.
Steroid hormones sulfatase inactivation extends lifespan and ameliorates age-related diseases.
Nat Commun 2021 12(1) 49
[ PubMed ID = 33397961 ] [ RRC reference ]

Lu M, Tan L, Zhou XG, Yang ZL, Zhu Q, Chen JN, Luo HR, Wu GS.
Secoisolariciresinol Diglucoside Delays the Progression of Aging-Related Diseases and Extends the Lifespan of Caenorhabditis elegans via DAF-16 and HSF-1.
Oxid Med Cell Longev 2020 2020 1293935
[ PubMed ID = 32733632 ] [ RRC reference ]

Schmeisser S, Li S, Bouchard B, Ruiz M, Des Rosiers C, Roy R.
Muscle-Specific Lipid Hydrolysis Prolongs Lifespan through Global Lipidomic Remodeling.
Cell Rep 2019 29(13) 4540-4552.e8
[ PubMed ID = 31875559 ] [ RRC reference ]

Ranawade A, Mallick A, Gupta BP.
PRY-1/Axin signaling regulates lipid metabolism in Caenorhabditis elegans.
PLoS One 2018 13(11) e0206540
[ PubMed ID = 30403720 ] [ RRC reference ]

Goh GYS, Winter JJ, Bhanshali F, Doering KRS, Lai R, Lee K, Veal EA, Taubert S.
NHR-49/HNF4 integrates regulation of fatty acid metabolism with a protective transcriptional response to oxidative stress and fasting.
Aging Cell 2018 17(3) e12743
[ PubMed ID = 29508513 ] [ RRC reference ]

Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, Dillin A, Hansen M, Lapierre LR.
Autophagy-mediated longevity is modulated by lipoprotein biogenesis.
Autophagy 2016 12(2) 261-72
[ PubMed ID = 26671266 ] [ RRC reference ]

Yunger E, Safra M, Levi-Ferber M, Haviv-Chesner A, Henis-Korenblit S.
Innate immunity mediated longevity and longevity induced by germ cell removal converge on the C-type lectin domain protein IRG-7.
PLoS Genet 2017 13(2) e1006577
[ PubMed ID = 28196094 ] [ RRC reference ]

Wei Y, Kenyon C.
Roles for ROS and hydrogen sulfide in the longevity response to germline loss in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2016 113(20) E2832-41
[ PubMed ID = 27140632 ] [ RRC reference ]

Lin CJ, Wang MC.
Microbial metabolites regulate host lipid metabolism through NR5A-Hedgehog signalling.
Nat Cell Biol 2017 19(5) 550-557
[ PubMed ID = 28436966 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190
[ PubMed ID = 28379943 ] [ RRC reference ]

Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H.
Fatty acid desaturation links germ cell loss to longevity through NHR-80/HNF4 in C. elegans.
PLoS Biol 2011 9(3) e1000599
[ PubMed ID = 21423649 ] [ RRC reference ]

Webster CM, Deline ML, Watts JL.
Stress response pathways protect germ cells from omega-6 polyunsaturated fatty acid-mediated toxicity in Caenorhabditis elegans.
Dev Biol 2013 373(1) 14-25
[ PubMed ID = 23064027 ] [ RRC reference ]