Strain Name: atg14 / Allele: jt5

Allele jt5
Strain Name atg14
Type Mutant
Genotype
Affected Gene atg14
Origin and Depositor The University of Tokyo (Noboru Mizushima)
Link to ZFIN
Information
atg14 mutants (loss-of-function mutation) were generated by CRISPR/Cas9.

28-base deletion was introduced in exon6 of atg14 gene by using CRISPR method.
The heterozygous fish was identified by heteroduplex mobility assay using followed primers:
atg14-f, AACCACCTATCACTCGGGCCGCTGGATCT
atg14-r, CCCAAACCTCTGATTGGCAGTGCAG
Mutation:
5’-GCTGGGTGGAGGAGAAGAGTGGAAACCAGGGG-3’Wild-type allele
5’-G----------------------------GGG-3’Mutated allele (-28 bp)
 
The Conditions to Distribute Strains
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Morishita et al. Autophagy is required for maturation of surfactant-containing lamellar bodies in the lung and swim bladder. Cell Rep. 33: 108477(2020)
Prior to filing an application for a patent, or intellectual property or other rights based on the results of research using the BIOLOGICAL RESOURCE, the recipient shall acquire the consent from (or notify to) the DEPOSITOR for such application.
The BIOLOGICAL RESOURCE shall be used only for basic research purpose (NOT for commercial purpose).
The recipient shall acquire a prior consent from Dr. Noboru Mizushima by E-mail.
Noboru Mizushima（Email: nmizu@m.u-tokyo.ac.jp)  
Request To Order
Reference

Hideaki Morishita, Yuki Kanda, Takeshi Kaizuka, Haruka Chino, Kazuki Nakao, Yoshimi Miki, Yoshitaka Taketomi, Jun-Lin Guan, Makoto Murakami, Atsu Aiba, Noboru Mizushima Autophagy Is Required for Maturation of Surfactant-Containing Lamellar Bodies in the Lung and Swim Bladder Cell Rep 2020 ; 33(10) : 108477 .

 
Facility RIKEN Center for Brain Science