Strain Name: ptf1a / Allele: ex1+11

Allele ex1+11
Strain Name ptf1a
Type Mutant
Genotype
Affected Gene ptf1a
Origin and Depositor Nagoya University (Masahiko Hibi)
Link to ZFIN
Information
a 11 bp insertion was introduced in the exon1of ptf1a gene by CRISPR/Cas9 method. The mutation can be detected by PCR with the primers:
ptf1a-t2-F: 5'-GCTCTTTGCTGAGGTTCACC-3'
ptf1a-t2-R: 5'-CCAGAAGGGATCAGTCAGTA-3'

Mutation:
WT   GCAACAGTTGCGTCAAGCTGCCAACGTCCGGGAGCGACGGAGGATGC
MUT GCAACAGTTGCGTCAAGCTGCCAAGAAGAGGCGGGACGTCCGGGAGCGACGGAGGATGC
+11 bp  
The Conditions to Distribute Strains
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC.  
Request To Order
Reference
 
Facility RIKEN (Wako) CBS, Lab for Neural Circuit Dynamics of Decision Making