Strain Name: wnt8a / Allele: ORF1ORF2-1/+

Allele ORF1ORF2-1/+
Strain Name wnt8a
Type Mutant
Genotype
Affected Gene
Origin and Depositor Nagoya University (Masahiko Hibi)
Link to ZFIN
Information
Deletion mutantions are introduced in both ORF1 and ORF2 of wnt8a gene (-16 bp in ORF1, -9+5 in ORF2) by TALENs. The ORF1 mutation can be detected by PCR with the primers:ORF1-T1-short-F, CAGAGTGGTATAGAAGAGTGCA; ORF1-T1-short-R, CGCTTTCCGGGCAGTTCCACCT. The ORF2 mutation can be detected by PCR with the primers: ORF2-T2-short-F, TGGCATGTCAGAAAGTTGCACA
; ORF2-T2-short-R, AGTCAGCCAGTTGCATCCAGCA
. Zygotic homozygous mutant embryos show dorsalized and anteriorized phenotypes.  
The Conditions to Distribute Strains
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC.  
Request To Order
Reference
 
Facility RIKEN (Wako) CBS, Lab for Neural Circuit Dynamics of Decision Making