Strain Name: prdm8b / Allele: ex3-5 |
Allele | ex3-5 |
Strain Name | prdm8b |
Type | Mutant |
Genotype | |
Affected Gene | prdm8b |
Origin and Depositor | Nagoya University (Masahiko Hibi) |
Link to ZFIN |
Information | |
A deletion mutation (5 bp) was introduced in the exon3 of prdm8b gene by a CRISPR method. The mutation can be detected by PCR with the primers: prdm8b-ex3-5-f, GTCGGCCAGAGACAGAGATG prdm8b-ex3-5-r, GAATAGCTGGCCGTTCTTCA Mutation: WT TCGGCCAGAGACAGAGATGAACAGAACCTGGAGGCCTATGTGAAGAA |
The Conditions to Distribute Strains | |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC. |
Request |
Reference | |
Facility | RIKEN Center for Brain Science |