Strain Name: wnt8a / Allele: ORF2-3

Allele ORF2-3
Strain Name wnt8a
Type Mutant
Genotype
Affected Gene wnt8a
Origin and Depositor Nagoya University (Masahiko Hibi)
Link to ZFIN
Information
A deletion mutation (16 bp) was introduced in the ORF2 of wnt8a gene by a TALEN method. The mutation can be detected by PCR with the primers: ORF2-T1-short-F, AGAGGATTTGTAGATGTCATGG; ORF2-T1-short-R, TGCATCCAGCATGTTTGCATTG. Sequence of the TALEN's target is 5'-AGATGTCATGGCAT gtcagaaagttgcac AATGCAAACATGCTGG (upper and lower cases indicate TALEN binding sites and cleavage site, respectively).  
The Conditions to Distribute Strains
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC.  
Request To Order
Reference
 
Facility RIKEN Center for Brain Science