Strain Name: sybu / Allele: ex8-7

Allele ex8-7
Strain Name sybu
Type Mutant
Genotype
Affected Gene syntabulin (sybu)
Origin and Depositor Nagoya University (Masahiko Hibi)
Link to ZFIN
Information
A deletion mutation (7 bp) was introduced in the exon 8 of syntabulin gene by a TALEN method. 8-bp deletion (marked by red letters) and 1-bp insertion (a blue letter) were introduced: AGCAGTAACCTTACTCCACT.
SyntabulinT1F:GGCATCAAGCCTCCCAATCCCG
SyntabulinT1R:AATGGCCACTTCTTTCTGCTGT  
The Conditions to Distribute Strains
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC.  
Request To Order
Reference
 
Facility RIKEN Center for Brain Science