Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307241
Length 516 bp
Fasta Format > rwhyd10i23
cggcggcagaaggatttcaagtactctaaaacatttagctagaagggact aaaccattgatcataaccaccaacaaaaatattttccttgtttacagaac accatcgcacttcgcacttctgtttcaaacagattactttgaggtcgtct tgtccttggtcttctgtattttcaacaccttcttcacgatcttctgctcc tcaaccaagaaagcgcggatgatcctttccctcactgcagttccagagag cactccaccatagggacggttcacagtcctgcggttcctagacaaccttg atcttttgtattcagtaggcctgaggtggggaatcccctggatcttcttc ccggtcacagggcacttggggccgctcgccctcttcttggtgtactggta cactagcttaccacctggggtcttgacgacccgcgtctggttggacttgg tggcatagctgtgcctcttccggtaggtcaggcgctgcaccatgtttccg tcgtctccgccgccgc
Download
page-top