Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307198
Length 625 bp
Fasta Format > rwhyd10f24
gttgattgacattatacggaatgaaagaggattcaagctacaaaacttca cttagccaaaactcgcctcttgcttaaatgcaagacacaggagtttggat acatgacaaggtctgattaatttaactcctaacaacgaacccttaacaca agtagtaatacttcccccggaacccaaagactttgatttctcataaggtg ccggcggagtcctataagcaacatccgccgatccctggtcggcatcgttt atggttgagactaggacggtatctgatcgtcttcgagcccccaactttcg ttcttgattaatgaaaacatccttggcaaatgctttcgcagttgttcgtc tttcataaatccaagaatttcacctctgactatgaaatacgaatgccccc gactgtccctattaatcattactccgatcccgaaggccaacacaatagga ccggaatcctatgatgttatcccatgctaatgtatccagagcgatggctt gctttgagcactctaatttcttcaaagtaacgatgccggaaacacgaccc ggccaattaaggctaggagcgcgatgccggccgaagggtcgagtaggtcg gtgctcgccgtgaggcggaccggcc
Download
page-top