Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307197
Length 306 bp
Fasta Format > rwhyd10f22
caaaacgactcaacgcctcagaatcaggccttggcagcagcctgggcagc ggcatcccgctncctctgctcctcaatgatggcgagcttgatacccttgc ccttggggaggctcacccacggctnggngcccttgccgatggtgaacacg tngcccagacgggtggnaaactggtggccctgcgcatnctnaacgtggat ggtctnnaaggttcccttatgcttctccctgttcttgatcacaccaacac gcccagtgttgcgcccaccantaacnatgaccacattgccgacgtcaaac ttgatg
Download
page-top