Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ307196
Length 608 bp
Fasta Format > rwhyd10f19
gcatattaaccaggtgcaaagcaggttcaagatacaaggttcttacaaca caacaggttgtaaaacaaacaccacaaagcaaacgttcaaacagacagat aacagataaagccactcgggcagatcataggatagcagtagcaagccttg ggaaagcaccaggaggcaggcttaatactcatcgccctcatcaccgtcct caccctcgtcgaactcagcaccaacttcttcatagtccttctccagggca gcgagatcctcacgggcctcagagaactctccctcctccatgccctcacc gacgtaccagtggacgaaggcacgcttggcgtacatcaggtcaaacttgt ggtcgatgcgggagaagacctcgacgacactggtggagttggagatcatg cacacagccctctggaccttggcaaggtcaccgcctgggacgacacctgg tggctggtagttgataccacacttgaagccagtggggcaccagtcaacaa actgaatagtgcgcttggtcttgatggtggccacagcagcgttgacgtcc tttggcacaacatcaccacggtacatgagacagcaggccatgtactttgc cgtggcgg
Download
page-top